Candida pseudojiufengensis Bai et Ji (ATCC® MYA-4595)

Strain Designations: HJG-2.5.1 [AS 2.3693, CBS 10847]  /  Product Format: frozen

Permits Notice: Necessary Permits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Strain Designations HJG-2.5.1 [AS 2.3693, CBS 10847]
Biosafety Level 1
Product Format frozen
Type Strain yes
Comments
Insect associated yeast.
mitochondrial genome sequenced strain
Medium ATCC® Medium 200: YM agar or YM broth
Growth Conditions
Temperature: 25°C
Sequenced Data
ITS DNA sequence of MYA-4595 lot 58704091

GTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTACAGAATTTAAGTGCTTAATTGCATTTTTACACATGTGTTTTTCTTTTTTAAAACTTACTTTGGTAGTGCTATTAATTTAGTCGCTGCCAGAGATTAAACTTAAAACAAATTTTTATTTTAATTGTCAAATAAGATTATATAATAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATATGAATTGCAGATATTCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTCTGGTATTCCAGAGGGCATGCCTGTTTGAGCGTCATTTCTCCCTCATACCTTCGGGTTTGGTGTTGAGCAATACGCAGAGTTTGCTTGAAAGAAAGTAGGAGTATAACTAATGGATAGGTATAACCACTCATTGGACAACTCCAAAATTTTTCCAAATTCGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATC

Name of Depositor FY Bai
Special Collection ATCC
Chain of Custody
ATCC <-- FY Bai <-- ZH Ji
Isolation
Gut of Oxycetonia jucunda, Jiufeng Mountain, Beijing, China.
Cross References

Nucleotide (GenBank) : GU291264 ITS including 5.8S rRNA gene

References

Ji ZH, Jia JH, Bai FY. Four novel Candida species in the Candida albicans/ Lodderomyces elongisporus clade isolated from the gut of flower beetles. Antonie van Leeuwenhoek 95: 23-32, 2009.

Valach M, et al. Evolution of linear chromosomes and multipartite genomes in yeast mitochondria. Nucleic Acids Res. 39: 4202-4219, 2011.

Permits Notice: Necessary Permits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation