Saccharomyces kudriavzevii Naumov et al. (ATCC® MYA-4449)

Strain Designations: CBS 8840 (IFO 1802; NCYC 2889; MUCL 46198)  /  Product Format: frozen

Strain Designations CBS 8840 (IFO 1802; NCYC 2889; MUCL 46198)
Biosafety Level 1
Product Format frozen
Type Strain yes
Preceptrol® no
Genome Sequenced Strain

Yes

Comments
Genome sequencing strain (Washington University School of Medicine, USA).
Morphology On YM medium at 25°C after 2 days, colonies creamy white to dingy white, smooth, slightly raised, margin entire. Cells globose to subglobose, smooth, guttulate, 5.0-9.0 X 4.0-7.5 µm. Pseudohyphae not observed.
Medium Medium 200: YM agar or YM broth
Growth Conditions
Temperature: 24°C
Sequenced Data
ITS sequence

AAGGATCATTAAAGAAATTTAATAATTTTGAAAATGGATTTGTTTGTTTTGGCAAGAGCGTGAGAGCTTTTACTGGGCAAGTAGACAAGAGATGGAGAGTCCGGCCGGGCCTGCGCTTAAGTGCGCGGTCTTGCTAGGCTTGCAAGTTTCTTTCTTGCTATTCCAAACAGTGAGAGATTTCTCTGTTTTCGTTATAGGACAATCAAAACCGTTTCAATACAACACACTGTGGAGTTTTTATATCTTTGCAACTTTTTCTTTGGGCTGTCGAGCAATCGGAGCCCAGAGGTAACAAACACAAACAATTTTATTTATTCATTAAATTTTTGTCAAAAACAAGAATTTTCGTAACTGGAAATTTTAAAAATATTAAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCAGGGGGCATGCCTGTTTGAGCGTCATTTCCTTCTCAAACATTCTGTTTGGTAGTGAGTGATACTCTTTGGAGTTAACTTGAAATTGCTGGCCTTTTCATTGGATGTTTTTTTTCCAAAGAGAGGTTTCTCTGCGTGCTTGAGGTATAATGCAAGTACGGTCGTTTTAGGTTTTACCAACTGCGGCTAATCTTTTTTGTACTGAGCGTATTGGAACGTTATCGATAAGAAGAGAGCGTCTAGGCGAACAATATTCTTAAAGTTTGACCTCAAATCAGGTAGGAGTACCCGCTGAACTTAA

 

D1D2 sequence

ATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGTACCTTCGGTGCCCGAGTTGTAATTTGGAGAGGGCAACTTTGGAACCGTTCCTTGTCTATGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTGTGGCGAGGAGTGCGGTTCTTTTGTAAAGTGCCTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGCATTTGATCAGACATGGTGTTTTGCGCCCTCTGCTCCTTGTGGGTGGGGGAATCTCGCATTTCACTGGGCCAGCATCAGTTTTGGTGGCAGGATAAATCCGTAGGAATGTAACTTGCTTCGGGAAGTATTATAGCCTGCGGGAATACTGCCAGCTGGGACTGAGGACTGCGACGTAAGTCAAGGATGCTGGCATAATGGTTATATGCCG

Morphology On YM medium at 25°C after 2 days, colonies creamy white to dingy white, smooth, slightly raised, margin entire. Cells globose to subglobose, smooth, guttulate, 5.0-9.0 X 4.0-7.5 µm. Pseudohyphae not observed.
Name of Depositor CBS
Special Collection ATCC
Chain of Custody
ATCC <-- CBS
Isolation
Decayed leaf, Japan
Cross References

Nucleotide (GenBank) : FJ196731 D1/D2 region of 28S rRNA gene

Nucleotide (GenBank) : FJ196779 ITS including 5.8S rRNA gene

References

Naumov GI, et al. Three new species in the Saccharomyces sensu stricto complex: Saccharomyces cariocanus, Saccharomyces kudriavzevii and Saccharomyces mikatae. Int. J. Syst. Evol. Microbiol. 50: 1931-1942, 2000. PubMed: 11034507

Cliften P, et al. Finding functional features in Saccharomyces genomes by phylogenetic footprinting. Science 30: 71-76, 2003. PubMed: 2775844

Wang H, et al. A fungal phylogeny based on 82 complete genomes using the composition vector method. BMC Evol. Biol. 9: 195, 2009.