Phytophthora infestans (Montagne) de Bary (ATCC® MYA-4127)

Strain Designations: T30-4  /  Product Format: frozen

Permits and Restrictions

View Permits

Strain Designations T30-4
Biosafety Level 1
Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Genome Sequenced Strain

Yes

Comments
Plant pathogen.
Genome sequencing strain (Broad Institute, USA).
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

AAGGATCATTACCACACCTAAAAACTTTCCACGTGAACCGTTTCAACCCAATAGTTGGGGGTCTTACTTGGCGGCGGCTGCTGGCTTTATTGCTGGCGGCTACTGCTGGGCGAGCCCTATCAAAAGGCGAGCGTTTGGACTTCGGTCTGAGCTAGTAGCTTTTTTATTTTAAACCCTTTACTTAATACTGATTATACTGTGGGGACGAAAGTCTCTGCTTTTAACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGAAGTATGCCTGTATCAGTGTCCGTACAACAAACTTGGCTTTCTTCCTTCCGTGTAGTCGGTGGAGGAGATGCCAGATGTGAAGTGTCTTGCGGTTGGTTTTCGGACCGACTGCGAGTCCTTTTAAATGTACTAAACTGTACTTCTCTTTGCTCCAAAAGTGGTGGCATTGCTGGTTGTGGACGCTGCTATTGTAGCGAGTTGGCGACCGGTTTGTCTGCTGCGGCGTTAATGGAGAAATGCTCGATTCGTGGTATGGTTGGCTTCGGCTGAACAATGCGCTTATTGGGTGATTTTCCTGCTGTGGCGTGATGGACTGGTGAACCATGGCTCTTTAGCTTGGCATTTGAATCGGCTTTGCTGTTGCGAAGTAGAGTGGCGGCTTCGGCTGCCGAGGGTCGATCCATTTGGGAAATGTTGTGTACTTCGGTATGCATCTCAATTGGACCTGATATCAGGCAAGATTACCCGCTGA


D1D2 region of the 28S ribosomal RNA gene

CATCTCAATTGGACCTGATATCAGGCAAGATTACCCGCTGAACTTAAGCATATTAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGCGCGGCGAATTGTAGTCTATAGAGGCGTGATCAGTGTGGGCGCTTGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCCTGAGTTGCTCGTGCGTACGATCCGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCCGTGGTATATTTCATTGGCGAGTGTGTGCGTGCGTGTGCTGTGGCAGCGGCTTTTTTGGCTGCGCTCGGCGTGTGTGCTGTGTGTGCTTGCTGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCCGCCGAGGAGGTAGGGCTTACGCTTGCGTTTGTCTGTTATATCTTGGTGGACGAGTAGTCGCGGTTGGGACTGAGGTGCCTACAACGTGTTTTTGAGTGGGCCTGTGTCTCTGTGTGCGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATTGATGTGGGTTTTAACTTGTTG

Name of Depositor F Govers
Special Collection NSF - Mycology
Chain of Custody
ATCC <-- F Govers
Isolation
Potato (Solanun tuberosum), Netherlands.
Geographical Isolation Generated in Laboratory of Phytopathology
Cross References

Complete Genome (GenBank) : AATU00000000 Phytophthora infestans T30-4, whole genome shotgun sequencing project

References

Haas BJ, et al. Genome sequence and analysis of the Irish potato famine pathogen Phytophthora infestans. Nature 461:393-398, 2009. PubMed: 19741609

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
  • USDA APHIS PPQ Permit 526, plant pathogens permit must be obtained and a copy of the permit must be sent to ATCC in advance of shipment. Isolation information for this item is required by USDA. Please check our website or contact Technical Service for assistance. Domestic isolates are easier to obtain than foreign isolates.
Basic Documentation