Scheffersomyces stipitis (Pignal) Kurtzman et Suzuki (ATCC® 58785)

Strain Designations: CBS 6054 [CCRC 21777, IFO 10063, NRRL Y-11545]  /  Product Format: freeze-dried

Permits and Restrictions

View Permits

Deposited As Pichia stipitis Pignal
Strain Designations CBS 6054 [CCRC 21777, IFO 10063, NRRL Y-11545]
Application
Bioethanol production
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format freeze-dried
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Genome Sequenced Strain

Yes

Comments
Use of corn steep liquor in fermentation of D-xylose
Genome sequencing strain (completed by the Joint Genome Institute at the Department of Energy, USA).
Morphology On YM medium at 25°C after 2 days, colonies creamy white to dingy white, smooth, slightly raised, margin entire. Cells subglobose to ellipsoid, smooth, guttulate, 4-8 X 3-5 µm.
Medium ATCC® Medium 200: YM agar or YM broth
ATCC® Medium 1245: YEPD
ATCC® Medium 28: Emmons' modification of Sabouraud's agar
Growth Conditions
Temperature: 24°C to 26°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

GGTTTCCGTAGGTGAACCTGCGGAAGGATCATTACAGTATTCTTTTTGCCAGCGCTTAACTGCGCGGCGAAAAAACCTTACACACAGTGTTTTCTTTATTAGAAACTATTGCTTTGGTCTGGCTCAGAAATGAGTTGGGCCAGAGGTTTACCAAACTTCAATTTTATTGAATTGTTATTTTATTAATTTGTCAATTTGTTGATTAAATTCAAAAATCTTCAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATATGAATTGCAGATTTTCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTTGAGCGTCATTTCTCTCTCAAACCCTCGGGTTTGGTATTGAGTGATACTCTTAGTCGAACTAGGCGTTTGCTTGAAAAGTATTGGCACGAGTGGTACTAAATAGTACTGACAGAATATTTCAATGTATTAGGTTTATCCAACTCGTTGAGACTTCTGGCGGTGAATTTTTGGTATATTGGCTTTGCCTTACAAAACAACAAACAAGTTTGACCTCAAATCAGGTAGGATTACCCGCTGAACTTAAGCATATCAATAA


D1D2 region of the 26S ribosomal RNA gene

ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCACCTTCGGTGTCCGAGTTGTAATTTGAAGAAGGTAACTTTGGAGTCAGCTCTTGTCTATGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTGCGATGAGATGTCTGATTCTATGTAAAGTGCTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGTTTGAGATCAGACTTGGTATTTTGTATGTCTTGCTTTCGGGTGGGGCCTCTACAGTTTACTGGGCCAGCATCGGTTTGGACGGTAGGATAATGACATTGGAATGTGGCACCACTTCGGTGGTGTGTTATAGACTTTGTTGATACTGCCTGTCTAGACCGAGGACTGCGTCTTTGACTAGGATGCTGGCATAATGATCTTAAACCGC

Morphology On YM medium at 25°C after 2 days, colonies creamy white to dingy white, smooth, slightly raised, margin entire. Cells subglobose to ellipsoid, smooth, guttulate, 4-8 X 3-5 µm.
Name of Depositor CBS
Chain of Custody
ATCC <-- CBS <-- J Santa Maria
Cross References

Nucleotide (GenBank) : CM000437 Pichia stipitis CBS 6054 chromosome 1, whole genome shotgun sequence.

Nucleotide (GenBank) : AAVQ00000000 Scheffersomyces stipitis CBS 6054 chromosome 1, whole genome shotgun sequencing project

Nucleotide (GenBank) : AF030426 nucleotide sequence of PsCYC1

Nucleotide (GenBank) : U08628 Pichia stipitis CBS 6054 ATCC 58785 autonomous replication

Nucleotide (GenBank) : U08629 Pichia stipitis CBS 6054 ATCC 58785 orotidine-5'-phosphate

Nucleotide (GenBank) : AF127801 Pichia stipitis xylitol dehydrogenase (XYL2) gene, complete cds.

References

Toivola A, et al. Alcoholic fermentation of D-xylose by yeasts. Appl. Environ. Microbiol. 47: 1221-1223, 1984.

Deed RW, et al. Xylitol production by recombinant Saccharomyces cerevisiae. Bio-Technology 9: 1090-1095, 1991. PubMed: 1367625

Amartey S, Jeffries TW. Comparison of corn steep liquor with other nutrients in the fermentation of D-Xylose by Pichia stipitis CBS 6054. Biotechnol. Lett. 16: 211-214, 1994.

Shi NQ, et al. Disruption of the cytochrome c gene in xylose-utilizing yeast Pichia stipitis leads to higher ethanol production. Yeast 15: 1021-1030, 1999. PubMed: 10455226

Jeffries TW, et al. Genome sequence of the lignocellulose-bioconvertingand xylose-fermenting yeast Pichia stipitis. Nat. Biotech. 25: 319-326, 2007. PubMed: 17334359

Wang H, et al. A fungal phylogeny based on 82 complete genomes using the composition vector method. BMC Evol. Biol. 9: 195, 2009. PubMed: 19664262

Rosenblad MA, et al. Kinship in the SRP RNA family. RNA Biol. 6: 508-516, 2009. PubMed: 19838050

Taylor DJ, Bruenn J. The evolution of novel fungal genes from non-retroviral RNA viruses. BMC Biol. 7: 88, 2009. PubMed: 20021636

Andersen ES, et al. The tmRDB and SRPDB resources. Nucleic Acids Res. 34: D163-D168, 2006. PubMed: 16381838

Shi NQ, et al. SHAM-sensitive alternative respiration in the xylose-metabolizing yeast Pichia stipitis. Yeast 19: 1203-1220, 2002. PubMed: 12271457

Jin YS, et al. Molecular cloning of XYL3 (D-xylulokinase) from Pichia stipitis and characterization of its physiological function. Appl. Environ. Microbiol. 68: 1232-1239, 2002. PubMed: 11872473

Shi NQ, et al. Characterization and complementation of a Pichia stipitis mutant unable to grow on D-xylose or L-arabinose. Appl. Biochem. Biotechnol. Spring 84-86: 201-216, 2000. PubMed: 10849789

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation