Microsporum canis Bodin, anamorph (ATCC® 36299)

Alternate State: Arthroderma otae (Hasegawa et Usui) McGinnis et al., teleomorph  /  Strain Designations: A 3697 (2)  /  Product Format: frozen

Permits and Restrictions

View Permits

Strain Designations A 3697 (2)
Alternate State Arthroderma otae (Hasegawa et Usui) McGinnis et al., teleomorph
Application
Biomedical Research and Development Material
Biosafety Level 2
Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Comments
Mitochondrial genome sequenced strain.
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence.

GTCGAAGTTGCCCCCCGAAGCTCTTCCGTCTCCCCCCCGGGCCTCCCGGGGAGGTTGCGGGCGGCGAGGGGTGCCTCCGGCCGCACGCCCATTCTTGTCTACTGACCCGGTTGCCTCGGCGGGCCGCGCCTGCTGTGCTACAGCGGCCGTTCGGGGGGGACGCCTGAGGGGGACTCTTGTTTCCTAGGCCACGCCCCGGGCAGCGCTCGCCGGAGGATTACTCTGGAAAACACACTCTTGAAAGAACATACCGTCTGAGCGAGCAACGCAAATCAGTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGCATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCAACCCCTCAAGCCCGGCTTGTGTGATGGACGACCGTCCCCCCTCCCCAGTAACCACCCACCGCTTAGGGGGGTGGGAGGGAGGGGGACGCGCCCGAAAAGCAGTGGTCAGGCCGCGATTCCGGCTCCTGGGCGAATGGGACATACCACCGCCTCCAGGACCGGCCGGCAGGCTGGCCTAACGCACCATGTATTATTCAGGTGACCTCGGATCA

Name of Depositor H Saez
Isolation
Human lesion
Cross References

Nucleotide (GenBank) : FJ545254 ITS including 5.8S rRNA gene

References

Wu Y, et al. Recent dermatophyte divergence revealed by comparative and phylogenetic analysis of mitochondrial genomes. BMC Genomics 10: 238, 2009.

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation