Aspergillus terreus Thom, anamorph (ATCC® 20542)

Strain Designations: MF4845  /  Product Format: freeze-dried

Permits Notice: Necessary Permits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Strain Designations MF4845
Application
produces hypocholesterolemic agents
produces hypolipemic agents
produces lovastatin
produces mevinolin
produces mevinolinic acid
Biosafety Level 1
Product Format freeze-dried
Type Strain no
Genome Sequenced Strain

Yes

Comments
Genome sequencing strain (Microbia, Inc., USA). Our DNA sequencing results raised the question about the strain's identity as Aspergillus terreus. Further investigation is planned.
Medium ATCC® Medium 324: Malt extract agar
Growth Conditions
Temperature: 26.0°C
Sequenced Data
 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence.

AAATGCGTCGGCGGGCGCCGGCCGGGCCTACGGAGCGGAAGACGAAGCCCCATACGCTCGAGGACCGGACGCGGTGCCGCCGCTGCCTTTCGGGCCCGTCCCCCGGGAGCCGGGGGACGAGGGCCCAACACACAAGCCGGGCTTGAGGGCAGCAATGACGCTCGGACAGGCATGCCCCCCGGAATACCAGGGGGCGCAATGTGCGTTCAAAGACTCGATGATTCACTGAATTCTGCAATTCACATTAGTTATCGCATTTCGCTGCGTTCTTCATCGATGCCGGAACCAAGAGATCCATTGTTGAAAGTTTTAACTGATTGCAAAGAATCACACTCAGACTGCAAGCTTTCAGAACAGGGTTCATGTTGGGGTCTCCGGCGGGCACGGGCCCGGGGGCGAGTCGCCCCCCGGCGGCCAGCAACGCTGGCGGGCCCGCCGAAGCAACAAGGTACAATAGTCACGGGTGGGAGG

Name of Depositor Merck & Co., Inc.
Cross References

Nucleotide (GenBank) : GU256759 ITS including 5.8S rRNA gene

References

Greenspan MD, Yudkovitz JB. Mevinolinic acid biosynthesis by Aspergillus terreus and its relationship to fatty acid biosynthesis. J. Bacteriol. 162: 704-707, 1985. PubMed: 3988710

Moore RN, et al. Biosynthesis of the hypocholesterolemic agent mevinolin by Aspergillus terreus. Determination of the origin of carbon, hydrogen, and oxygen atoms by 13C NMR and mass spectrometry. J. Am. Chem. Soc. 107: 3694-3701, 1985.

Lam TY. Hypocholesterolemic fermentation products. US Patent 4,376,863 dated Mar 15 1983

Hajko P, et al. Process for the isolation of lovastatin. US Patent 5,712,130 dated Jan 27 1998

Alberts AW, et al. Mevinolin: a highly potent competitive inhibitor of hydroxymethylglutaryl-coenzyme A reductase and a cholesterol-lowering agent. Proc. Natl. Acad. Sci. USA 77: 3957-3961, 1980. PubMed: 6933445

Askenazi M, et al. Integrating transcriptional and metabolite profiles to direct the engineering of lovastatin-producing fungal strains. Nat. Biotechnol. 21: 150-156, 2003.

Permits Notice: Necessary Permits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation