Aspergillus terreus Thom, anamorph (ATCC® 20542)

Strain Designations: MF4845  / 

Permits and Restrictions

View Permits

Deposited As Aspergillus terreus Thom
Strain Designations MF4845
Application
Produces hypocholesterolemic agents
Produces hypolipemic agents
Produces lovastatin
Produces mevinolin
Produces mevinolinic acid
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Genome Sequenced Strain

Yes

Comments Genome sequencing strain (Microbia, Inc., USA)
Medium ATCC® Medium 200: YM agar or YM broth
ATCC® Medium 324: Malt extract agar
ATCC® Medium 336: Potato dextrose agar (PDA)
Growth Conditions
Temperature: 24°C to 26°C
Atmosphere: Typical aerobic
Sequenced Data
 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence.

AAATGCGTCGGCGGGCGCCGGCCGGGCCTACGGAGCGGAAGACGAAGCCCCATACGCTCGAGGACCGGACGCGGTGCCGCCGCTGCCTTTCGGGCCCGTCCCCCGGGAGCCGGGGGACGAGGGCCCAACACACAAGCCGGGCTTGAGGGCAGCAATGACGCTCGGACAGGCATGCCCCCCGGAATACCAGGGGGCGCAATGTGCGTTCAAAGACTCGATGATTCACTGAATTCTGCAATTCACATTAGTTATCGCATTTCGCTGCGTTCTTCATCGATGCCGGAACCAAGAGATCCATTGTTGAAAGTTTTAACTGATTGCAAAGAATCACACTCAGACTGCAAGCTTTCAGAACAGGGTTCATGTTGGGGTCTCCGGCGGGCACGGGCCCGGGGGCGAGTCGCCCCCCGGCGGCCAGCAACGCTGGCGGGCCCGCCGAAGCAACAAGGTACAATAGTCACGGGTGGGAGG

Name of Depositor Merck & Co., Inc.
U.S. Patent Number
Disclosure This material is cited in a US or other Patent and may not be used to infringe the claims. Depending on the wishes of the Depositor, ATCC may be required to inform the Patent Depositor of the party to which the material was furnished.
Cross References

Nucleotide (GenBank) : GU256759 ITS including 5.8S rRNA gene

References

Greenspan MD, Yudkovitz JB. Mevinolinic acid biosynthesis by Aspergillus terreus and its relationship to fatty acid biosynthesis. J. Bacteriol. 162: 704-707, 1985. PubMed: 3988710

Moore RN, et al. Biosynthesis of the hypocholesterolemic agent mevinolin by Aspergillus terreus. Determination of the origin of carbon, hydrogen, and oxygen atoms by 13C NMR and mass spectrometry. J. Am. Chem. Soc. 107: 3694-3701, 1985.

Lam TY. Hypocholesterolemic fermentation products. US Patent 4,376,863 dated Mar 15 1983

Hajko P, et al. Process for the isolation of lovastatin. US Patent 5,712,130 dated Jan 27 1998

Alberts AW, et al. Mevinolin: a highly potent competitive inhibitor of hydroxymethylglutaryl-coenzyme A reductase and a cholesterol-lowering agent. Proc. Natl. Acad. Sci. USA 77: 3957-3961, 1980. PubMed: 6933445

Askenazi M, et al. Integrating transcriptional and metabolite profiles to direct the engineering of lovastatin-producing fungal strains. Nat. Biotechnol. 21: 150-156, 2003.

Schierova M, Linka M, Pazoutova S. Sulfate assimilation in Aspergillus terreus: analysis of genes encoding ATP-sulfurylase and PAPS-reductase. Curr. Genet. 38: 126-131, 2000. PubMed: 11057445

Hendrickson L, et al. Lovastatin biosynthesis in Aspergillus terreus: characterization of blocked mutants, enzyme activities and a multifunctional polyketide synthase gene. Chem. Biol. 6: 429-439, 1999. PubMed: 10381407

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation