Yarrowia lipolytica (Wickerham et al.) van der Walt et von Arx, teleomorph (ATCC® 20460)

Alternate State: Candida lipolytica (Harrison) Diddens et Lodder, anamorph  /  Strain Designations: IFP29 [CBS 7504, W29, CLIB 89]  /  Product Format: freeze-dried

Permits Notice: Necessary Permits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Deposited As Endomycopsis lipolytica Wickerham et al., teleomorph
Strain Designations IFP29 [CBS 7504, W29, CLIB 89]
Alternate State Candida lipolytica (Harrison) Diddens et Lodder, anamorph
Application
produces citric acid citrate
produces isocitric acid isocitrate
Biosafety Level 1
Product Format freeze-dried
Type Strain no
Genome Sequenced Strain

Yes

Mating Type mates with ATCC 18944 mating type A mates with ATCC 18944 RefGaillardin CM, et al. A study of copulation, sporulation and meiotic segregation in Candida lipolytica. Arch. Mikrobiol. 92: 69-83, 1973. PubMed: 4725824
Comments
Aconitase
Genome sequencing strain (Genolevures Consortium, France).
Morphology After 5 days on YM media colonies butyrous to mycelial and tannish-white in color. Cells are spheroidal, ellipsoidal to elongate and single, in pairs or small clusters. Pseudohyphae and true hyphae are usually present.
Medium ATCC® Medium 200: YM agar or YM broth
ATCC® Medium 1245: YEPD
ATCC® Medium 28: Emmons' modification of Sabouraud's agar
Growth Conditions Temperature: 20°C to 25°C
Atmosphere: Typical aerobic 
Sequenced Data
Large subunit ribosomal RNA gene, partial sequence; GenBank number: KC585416

TGCCTCAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAACCCTCGGGATTGTAATTTGAAGATTTGGCATTGGAGAAAGCTAACCCAAGTTGCTTGGAATAGTACGTCATAGAGGGTGACAACCCCGTCTGGCTAACCGTTCTCCATGTATTGCCTTATCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAGTGGGTGGTAAACTCCATCTAAAGCTAAATACTGGTGAGAGACCGATAGCGAACAAGTACTGTGAAGGAAAGGTGAAAAGAACTTTGAAAAGAGAGTGAAATAGTATGTGAAATTGTTGATAGGGAAGGAAATGAGTGGAGAGTGGCCGAGGTTTCAGCCGCCCCTCGTGGGCGGTGTACTGCCGACGCCGAGTCATCGATAGCGAGACGAGGGTTACAAATGGGAGCGCCTT

Morphology After 5 days on YM media colonies butyrous to mycelial and tannish-white in color. Cells are spheroidal, ellipsoidal to elongate and single, in pairs or small clusters. Pseudohyphae and true hyphae are usually present.
Name of Depositor C Gaillardin
Isolation
soil
Cross References

Nucleotide (GenBank) : X65225 Y.lipolytica PHO2 gene for acid phosphatase.

Nucleotide (GenBank) : AJ006754 Yarrowia lipolytica URA5-SEC65 gene region.

Nucleotide (GenBank) : Z34956 Y.lipolytica HOY1 gene for DNA-binding protein.

Nucleotide (GenBank) : Z49114 Y.lipolytica LYS1 gene for homocitrate synthase.

Nucleotide (GenBank) : Z22571 Y.lipolytica orotate phosphoribosyl transferase gene.

Nucleotide (GenBank) : Z23265 Y.lipolytica CRF1 gene encoding product required for copper.

Nucleotide (GenBank) : Z22570 Y.lipolytica signal recognition particle protein (SRP19) gene.

Nucleotide (GenBank) : Z46872 Y.lipolytica gene for exo-1,3-beta-glucanase/1,3-beta-D-glucan.

Nucleotide (GenBank) : Z23264 Y.lipolytica MTP1 and MTP2 genes encoding metallothionein-I and metallothionein-II.

Nucleotide (GenBank) : KC585416 Large subunit ribosomal RNA gene, partial sequence

References

Maldonado P, Charpentier M. Fermentation process for the production of citric and isocitric acids. US Patent 3,997,399 dated Dec 14 1976

Gaillardin CM, et al. A study of copulation, sporulation and meiotic segregation in Candida lipolytica. Arch. Mikrobiol. 92: 69-83, 1973. PubMed: 4725824

. . Agric. Biol. Chem. 42: 1201-1206, 1978.

. . French Patent 72/41 913

Souciet JL, et al. Genomic Exploration of the Hemiascomycetous Yeasts: 1. A set of yeast species for molecular evolution studies. FEBS Lett. 487: 3-12, 2000.

Casaregola S, et al. Genomic Exploration of the Hemiascomycetous Yeasts: 17. Yarrowia lipolytica. FEBS Lett. 487: 95-100, 2000.

Knutsen AK, et al. Polyphasic re-examination of Yarrowia lipolytica strains and the description of three novel Candida species: Candida oslonensis sp. nov., Candida alimentaria sp. nov. and Candida hollandica sp. nov. Int. J. Syst. Evol. Microbiol. 57: 2426-2435, 2007. PubMed: 17911320

Wang H, et al. A fungal phylogeny based on 82 complete genomes using the composition vector method. BMC Evol. Biol. 9: 195, 2009.

Gaillardin CM, et al. A study of copulation, sporulation and meiotic segregation in Candida lipolytica. Arch. Mikrobiol. 92: 69-83, 1973. PubMed: 4725824

Permits Notice: Necessary Permits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation