Cochliobolus sativus (Ito et Kuribayashi) Drechsler ex Dastur, teleomorph (ATCC® 201652)

Alternate State: Bipolaris sorokiniana (Saccardo) Shoemaker, anamorph  /  Strain Designations: ND90Pr  /  Product Format: frozen

Permits Notice: Necessary Permits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
  • USDA APHIS PPQ Permit 526, plant pathogens permit must be obtained and a copy of the permit must be sent to ATCC in advance of shipment. Isolation information for this item is required by USDA. Please check our website or contact Technical Service for assistance. Domestic isolates are easier to obtain than foreign isolates.
Strain Designations ND90Pr
Alternate State Bipolaris sorokiniana (Saccardo) Shoemaker, anamorph
Application
Tester for mating type A
Biosafety Level 1
Product Format frozen
Type Strain no
Genotype pathotype 2 RefValjavec-Gratian M, Steffenson BJ. Pathotypes of Cochliobolus sativus on barley in North Dakota. Plant Dis. 81: 1275-1278, 1997.
Genome Sequenced Strain

Yes

Mating Type a MAT-2 RefZhong S, Steffenson BJ. ZhongGenetic and molecular characterization of mating type genes in Cochliobolus sativus. Mycologia 93: 852-863, 2001.
Comments
differential virulence
Genome sequencing strain (the Joint Genome Institute at the Department of Energy, USA).
Morphology After 5 days at 20°C colonies floccose with grey aerial mycelium and reverse dark brown to black.  Later conidia curved to straight, fusiform to broadly ellipsoidal, 3-12 distoseptate, 40-120 x 17-28 µm.
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence.

GCCTGGCTTCGCGGCCGGCTGAAATATTTTTTTCACCCATGTCTTTTGCGCACTTGTTGTTTCCTGGGCGGGTTCGCCCGCCACCAGGACCAAACCATAAACCTTTTTTTTATGCAGTTGCAATCAGCGTCAGTAAAAACAATGTAATTATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCTTCAAGCTTTGCTTGGTGTTGGGCGTTTTTTGTCTCCCTCTTTCTGGGAGACTCGCCTTAAAACGATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACATATTTTGCGCTTTGTATCAGGAGAAAAGGACGGTAATCCATCAAGACTCTACATTTTTAACTTTTGACCTCGGATCAGGTAG

Morphology After 5 days at 20°C colonies floccose with grey aerial mycelium and reverse dark brown to black.  Later conidia curved to straight, fusiform to broadly ellipsoidal, 3-12 distoseptate, 40-120 x 17-28 µm.
Name of Depositor BJ Steffenson
Isolation
barley leaves, Hordeum vulgare line I86-519-1, Prosper, Cass Co., ND
Cross References

Nucleotide (GenBank) : JQ070161 D1/D2 region of 28S rRNA gene

Nucleotide (GenBank) : JQ070090 ITS including 5.8S rRNA gene

References

Fetch TG Jr., Steffenson BJ. Identification of Cochliobolus sativus isolates expressing differential virulence on two-row barley genotypes from North Dakota. Can. J. Plant Pathol. 16: 202-206, 1994.

Valjavec-Gratian M, Steffenson BJ. Genetics of virulence in Cochliobolus sativus and resistance in barley. Phytopathology 87: 1140-1143, 1997.

Valjavec-Gratian M, Steffenson BJ. Pathotypes of Cochliobolus sativus on barley in North Dakota. Plant Dis. 81: 1275-1278, 1997.

Zhong S, Steffenson BJ. ZhongGenetic and molecular characterization of mating type genes in Cochliobolus sativus. Mycologia 93: 852-863, 2001.

Ohm RA, et al. Diverse lifestyles and strategies of plant pathogenesis encoded in the genomes of eighteen Dothideomycetes fungi. PLoS Pathog 8(12): EPub Ahead of Print, 2012. PubMed: 23236275

Valjavec-Gratian M, Steffenson BJ. Pathotypes of Cochliobolus sativus on barley in North Dakota. Plant Dis. 81: 1275-1278, 1997.

Zhong S, Steffenson BJ. ZhongGenetic and molecular characterization of mating type genes in Cochliobolus sativus. Mycologia 93: 852-863, 2001.

Permits Notice: Necessary Permits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
  • USDA APHIS PPQ Permit 526, plant pathogens permit must be obtained and a copy of the permit must be sent to ATCC in advance of shipment. Isolation information for this item is required by USDA. Please check our website or contact Technical Service for assistance. Domestic isolates are easier to obtain than foreign isolates.
Basic Documentation