Candida albicans (Robin) Berkhout, anamorph (ATCC® 18804)

Strain Designations: CBS 562 [572, CCRC 20512, CECT 1002, DBVPG 6133, IFO 1385, IGC 3436, JCM 1542, NCYC 597, NRRL Y-12983]  /  Product Format: freeze-dried

Strain Designations CBS 562 [572, CCRC 20512, CECT 1002, DBVPG 6133, IFO 1385, IGC 3436, JCM 1542, NCYC 597, NRRL Y-12983]
Application
Induction of cell-mediated immunity against Candida albicans
Biosafety Level 1
Product Format freeze-dried
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain yes
Preceptrol® yes
Comments
Adhesion to epithelial cells
Induction of cell-mediated immunity against Candida albicans
MIC of 2-hydroxychalcone, 75 mcg/mL
Mitochondrial genome sequenced strain
Medium ATCC® Medium 28: Emmons' modification of Sabouraud's agar
ATCC® Medium 200: YM agar or YM broth
ATCC® Medium 1245: YEPD
Growth Conditions
Temperature: 25°C to 30°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

GTTTCCGTAGGTGAACCTGCGGAAGGATCATTACTGATTTGCTTAATTGCACCACATGTGTTTTTCTTTGAAACAAACTTGCTTTGGCGGTGGGCCCAGCCTGCCGCCAGAGGTCTAAACTTACAACCAATTTTTTATCAACTTGTCACACCAGATTATTACTTAATAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATATGAATTGCAGATATTCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTCTGGTATTCCGGAGGGCATGCCTGTTTGAGCGTCGTTTCTCCCTCAAACCGCTGGGTTTGGTGTTGAGCAATACGACTTGGGTTTGCTTGAAAGACGGTAGTGGTAAGGCGGGATCGCTTTGACAATGGCTTAGGTCTAACCAAAAACATTGCTTGCGGCGGTAACGTCCACCACGTATATCTTCAAACTTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAA


D1D2 region of the 26S ribosomal RNA gene

ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTCAGTAGCGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCGTCTTTGGCGTCCGAGTTGTAATTTGAAGAAGGTATCTTTGGGCCCGGCTCTTGTCTATGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTGCGATGAGATGACCCGGGTCTGTGTAAAGTTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGCTTGAGATCAGACTTGGTATTTTGCATGTTGCTCTCTCGGGGGCGGCCGCTGCGGTTTACCGGGCCAGCATCGGTTTGGAGCGGCAGGATAATGGCGGAGGAATGTGGCACGGCTTCTGCTGTGTGTTATAGCCTCTGACGATACTGCCAGCCTAGACCGAGGACTGCGGTTTTTACCTAGGATGTTGGCATAATGATCTTAAGTCGC

Name of Depositor CBS
Chain of Custody
ATCC <-- CBS <-- JE Mackinnon 572
Isolation
Human skin lesion of erosio interdigitalis, Uruguay
Cross References

Nucleotide (GenBank) : HQ876051 D1/D2 region of 28S rRNA gene

Nucleotide (GenBank) : HQ876043 ITS including 5.8S rRNA gene

Nucleotide (GenBank) : HQ876034 18S rRNA gene

Nucleotide (GenBank) : KC507436 EF-1 alpha gene

Nucleotide (GenBank) : KC507405 RPB1 gene

Nucleotide (GenBank) : KC512831 RPB2 gene

References

. Histoire naturelle des vegetaux parasites qui croissent sur l'homme et sur les animaux vivants. Paris: Balliere; 1853.

Sato M, et al. Growth inhibitory properties of chalcones to Candida. Lett. Appl. Microbiol. 18: 53-55, 1994.

Segal E, et al. Adhesion of Candida albicans to epithelial cells - effect of mikkomycin. Mycoses 40: 33-39, 1997. PubMed: 9260479

Kurtzman CP, Robnett CJ. Identification of clinically important ascomycetous yeasts based on nucleotide divergence in the 5' end of the large-subunit (26S) ribosomal DNA gene. J. Clin. Microbiol. 35: 1216-1223, 1997. PubMed: 9114410

Newman SL, Holly A. Candida albicans is phagocytosed, killed, and processed for antigen presentation by human dendritic cells. Infect. Immun. 69: 6813-6822, 2001. PubMed: 11598054

Valach M, et al. Evolution of linear chromosomes and multipartite genomes in yeast mitochondria. Nucleic Acids Res. 39: 4202-4219, 2011.

Suh SO, et al. Scheffersomyces parashehatae f.a., sp. nov., Scheffersomyces xylosifermentans f.a., sp. nov., Candida broadrunensis sp. nov., and Candida manassasensis sp. nov., four novel yeasts associated with wood- ingesting insects and their ecological and biofuel implications. Int. J. Syst. Evol. Microbiol. 63: 4330-4339, 2013. PubMed: 24014624