Candida albicans (Robin) Berkhout, anamorph (ATCC® 18804™)

Strain Designations: CBS 562 [572, CCRC 20512, CECT 1002, DBVPG 6133, IFO 1385, IGC 3436, JCM 1542, NCYC 597, NRRL Y-12983]  /  Product Format: freeze-dried

Permits Notice: Necessary Permits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Strain Designations CBS 562 [572, CCRC 20512, CECT 1002, DBVPG 6133, IFO 1385, IGC 3436, JCM 1542, NCYC 597, NRRL Y-12983]
Application
Induction of cell-mediated immunity against Candida albicans
Biosafety Level 1
Product Format freeze-dried
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Type Strain yes
Comments
Adhesion to epithelial cells
Induction of cell-mediated immunity against Candida albicans
MIC of 2-hydroxychalcone, 75 mcg/mL
Mitochondrial genome sequenced strain
Medium ATCC® Medium 200: YM agar or YM broth
ATCC® Medium 1245: YEPD
Growth Conditions
Temperature: 25°C to 30°C
Atmosphere: Typical aerobic
Sequenced Data
D1D2 region of the 28S ribosomal RNA gene:

AACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTCAGTAGCGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCGTCTTTGGCGTCCGAGTTGTAATTTGAAGAAGGTATCTTTGGGCCCGGCTCTTGTCTATGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTGCGATGAGATGACCCGGGTCTGTGTAAAGTTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGCTTGAGATCAGACTTGGTATTTTGCATGTTGCTCTCTCGGGGGCGGCCGCTGCGGTTTACCGGGCCAGCATCGGTTTGGAGCGGCAGGATAATGGCGGAGGAATGTGGCACGGCTTCTGCTGTGTGTTATAGCCTCTGACGATACTGCCAGCCTAGACCGAGGACTGCGGTTTTTACCTAGGATGTTGGCATAATGATCTTAAGTCGCCCGTCTTGAAACACGGA
Name of Depositor CBS
Chain of Custody
ATCC <-- CBS <-- JE Mackinnon 572
Isolation
Human skin lesion of erosio interdigitalis, Uruguay
Cross References

Nucleotide (GenBank) : HQ876051 D1/D2 region of 28S rRNA gene

Nucleotide (GenBank) : HQ876043 ITS including 5.8S rRNA gene

Nucleotide (GenBank) : HQ876034 18S rRNA gene

References

. Histoire naturelle des vegetaux parasites qui croissent sur l'homme et sur les animaux vivants. Paris: Balliere; 1853.

Sato M, et al. Growth inhibitory properties of chalcones to Candida. Lett. Appl. Microbiol. 18: 53-55, 1994.

Segal E, et al. Adhesion of Candida albicans to epithelial cells - effect of mikkomycin. Mycoses 40: 33-39, 1997. PubMed: 9260479

Kurtzman CP, Robnett CJ. Identification of clinically important ascomycetous yeasts based on nucleotide divergence in the 5' end of the large-subunit (26S) ribosomal DNA gene. J. Clin. Microbiol. 35: 1216-1223, 1997. PubMed: 9114410

Newman SL, Holly A. Candida albicans is phagocytosed, killed, and processed for antigen presentation by human dendritic cells. Infect. Immun. 69: 6813-6822, 2001. PubMed: 11598054

Valach M, et al. Evolution of linear chromosomes and multipartite genomes in yeast mitochondria. Nucleic Acids Res. 39: 4202-4219, 2011.

Permits Notice: Necessary Permits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation
Product Sheet
Product Sheet
Certificate of Analysis
Certificate of Analysis
MSDS
MSDS
Other Documentation
Other Document
Microbial Characterization Data