Torulaspora delbrueckii (Lindner) Lindner, teleomorph (ATCC® 10662)

Alternate State: Torulopsis taboadae Ulloa et Herrera, anamorph, Candida colliculosa (Hartmann) Meyer et Yarrow, anamorph  /  Strain Designations: NRRL Y-866 [CBS 1146, CCRC 21647, DBVPG 6167, I. Benda H10-99, IFO 0425, IFO 0955, IFO 1082, MUCL 27816, Wallerstein 129]  /  Product Format: freeze-dried

Permits and Restrictions

View Permits

Deposited As Saccharomyces delbrueckii Lindner
Strain Designations NRRL Y-866 [CBS 1146, CCRC 21647, DBVPG 6167, I. Benda H10-99, IFO 0425, IFO 0955, IFO 1082, MUCL 27816, Wallerstein 129]
Alternate State Torulopsis taboadae Ulloa et Herrera, anamorph, Candida colliculosa (Hartmann) Meyer et Yarrow, anamorph
Biosafety Level 1
Product Format freeze-dried
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain yes
Preceptrol® no
Genome Sequenced Strain

Yes

Comments
Genome sequencing strain (Wolfe Laboratory, Smurfit Institute of Genetics, Trinity College Dublin, Ireland)
Medium ATCC® Medium 28: Emmons' modification of Sabouraud's agar
ATCC® Medium 200: YM agar or YM broth
ATCC® Medium 1245: YEPD
Growth Conditions
Temperature: 24°C to 26°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

GGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAGAGAAATCTATATGAATGAAGTTAGAGGACGTCTAAAGATACTGTAAGAGAGGATCAGGTTCAAGACCAGCGCTTAATTGCGCGGTTGCGGCTTGGTTCGCCTTTTGCGGAACATGTCTTTTCTCGTTGTTAACTCTACTTCAACTTCTACAACACTGTGGAGTTTTCTACACAACTTTTCTTCTTTGGGAAGATACGTCTTGTGCGTGCTTCCCAGAGGTGACAAACACAAACAACTTTTTATTATTATAAACCAGTCAAAACCAATTTCGTTATGAAATTAAAAATATTTAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCAGGGGGCATGCCTGTTTGAGCGTCATTTCCTTCTCAAACAATCATGTTTGGTAGTGAGTGATACTCTGTCAAGGGTTAACTTGAAATTGCTAGCCTGTTATTTGGTTGTGATTTTGCTGGCTTGGATGACTTTGTCCAGTCTAGCTAATACCGAATTGTCGTATTAGGTTTTACCAACTTCGGCAGACTGTGTGTTGGCTCGGGCGCTTTAAAGACTTTGTCGTAAACGATTTATCGTTTGTTTGAGCTTTTCGCATACGCAATCCGGCGAACAATACTCTCAAAGTTTGACCTCAAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAA

Name of Depositor NRRL
References

. The yeasts: a taxonomic study. 3rd ed.Amsterdam: Elsevier; 1984.

Hendriks L, et al. The nucleotide sequence of the small ribosomal subunit RNA of the yeast Torulaspora delbrueckii. Nucleic Acids Res. 18: 4611, 1990. PubMed: 2388844

van der Walt JP, Johannsen E. The genus Torulaspora Lindner. CSIR Res. Rep. 325: 1-23, 1975.

Kurtzman CP. Phylogenetic circumscription of Saccharomyces, Kluyveromyces and other members of the Saccharomycetaceae, and the proposal of the new genera Lachancea, Nakaseomyces, Naumovia, Vanderwaltozyma and Zygotorulaspora. FEMS Yeast Res. 4: 233-245, 2003.

Gordon JL, et al. Evolutionary erosion of yeast sex chromosomes by mating-type switching accidents. Proc. Natl. Acad. Sci. USA. 108: 20024-20029, 2011. PubMed: 22123960

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation