Torulaspora delbrueckii (Lindner) Lindner (ATCC® 10662)

Alternate State: Torulopsis taboadae Ulloa et Herrera, anamorph, Candida colliculosa (Hartmann) Meyer et Yarrow, anamorph  /  Strain Designations: NRRL Y-866 [CBS 1146, CCRC 21647, DBVPG 6167, I. Benda H10-99, IFO 0425, IFO 0955, IFO 1082, MUCL 27816, Wallerstein 129]  /  Product Format: freeze-dried

Permits and Restrictions

View Permits

Deposited As Saccharomyces delbrueckii Lindner
Strain Designations NRRL Y-866 [CBS 1146, CCRC 21647, DBVPG 6167, I. Benda H10-99, IFO 0425, IFO 0955, IFO 1082, MUCL 27816, Wallerstein 129]
Alternate State Torulopsis taboadae Ulloa et Herrera, anamorph, Candida colliculosa (Hartmann) Meyer et Yarrow, anamorph
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format freeze-dried
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain yes
Preceptrol® no
Genome Sequenced Strain

Yes

Comments
Genome sequencing strain (Wolfe Laboratory, Smurfit Institute of Genetics, Trinity College Dublin, Ireland)
Medium ATCC® Medium 28: Emmons' modification of Sabouraud's agar
ATCC® Medium 200: YM agar or YM broth
ATCC® Medium 1245: YEPD
Growth Conditions
Temperature: 24°C to 26°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

GGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAGAGAAATCTATATGAATGAAGTTAGAGGACGTCTAAAGATACTGTAAGAGAGGATCAGGTTCAAGACCAGCGCTTAATTGCGCGGTTGCGGCTTGGTTCGCCTTTTGCGGAACATGTCTTTTCTCGTTGTTAACTCTACTTCAACTTCTACAACACTGTGGAGTTTTCTACACAACTTTTCTTCTTTGGGAAGATACGTCTTGTGCGTGCTTCCCAGAGGTGACAAACACAAACAACTTTTTATTATTATAAACCAGTCAAAACCAATTTCGTTATGAAATTAAAAATATTTAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCAGGGGGCATGCCTGTTTGAGCGTCATTTCCTTCTCAAACAATCATGTTTGGTAGTGAGTGATACTCTGTCAAGGGTTAACTTGAAATTGCTAGCCTGTTATTTGGTTGTGATTTTGCTGGCTTGGATGACTTTGTCCAGTCTAGCTAATACCGAATTGTCGTATTAGGTTTTACCAACTTCGGCAGACTGTGTGTTGGCTCGGGCGCTTTAAAGACTTTGTCGTAAACGATTTATCGTTTGTTTGAGCTTTTCGCATACGCAATCCGGCGAACAATACTCTCAAAGTTTGACCTCAAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAA

Name of Depositor NRRL
References

. The yeasts: a taxonomic study. 3rd ed.Amsterdam: Elsevier; 1984.

Hendriks L, et al. The nucleotide sequence of the small ribosomal subunit RNA of the yeast Torulaspora delbrueckii. Nucleic Acids Res. 18: 4611, 1990. PubMed: 2388844

van der Walt JP, Johannsen E. The genus Torulaspora Lindner. CSIR Res. Rep. 325: 1-23, 1975.

Kurtzman CP. Phylogenetic circumscription of Saccharomyces, Kluyveromyces and other members of the Saccharomycetaceae, and the proposal of the new genera Lachancea, Nakaseomyces, Naumovia, Vanderwaltozyma and Zygotorulaspora. FEMS Yeast Res. 4: 233-245, 2003.

Gordon JL, et al. Evolutionary erosion of yeast sex chromosomes by mating-type switching accidents. Proc. Natl. Acad. Sci. USA. 108: 20024-20029, 2011. PubMed: 22123960

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation