Candida tenuis Diddens et Lodder, anamorph (ATCC® 10573)

Strain Designations: NRRL Y-1498 [CBS 615, CCRC 21748, DBVPG 6159, IFO 10315, VKM Y-70]  /  Product Format: frozen

Permits Notice: Necessary Permits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Strain Designations NRRL Y-1498 [CBS 615, CCRC 21748, DBVPG 6159, IFO 10315, VKM Y-70]
Biosafety Level 1
Product Format frozen
Type Strain yes (Diddens HA, Lodder J. Die anaskosporogenen Hefen, zweite Halfte. Amsterdam: North-Holland; 1942.)
Genome Sequenced Strain

Yes

Comments
Genome sequencing strain (the Joint Genome Institute at the Department of Energy, USA; Wellcome Trust Sanger Institute, UK).
Medium ATCC® Medium 200: YM agar or YM broth
Growth Conditions
Temperature: 24.0°C
Sequenced Data
>26S ribosomal RNA gene, partial sequence.

ACCAACAGGGATTGCCTTAGTAGCGGCGAGTGAAGCGGCAATAGCTCAAATTTGAAATCTGGCGTCTTCGACGTCCGAGTTGTAATTTGAAGAAGGTATCTTTGGAATTGGCTCTTGTCTATGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTGCGATGAGATGCCCAATTCCGTGTAAAGTTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACTGTGAAGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGCTTGAGGTCAGACTTGGTTTTACCAGGCCAGCATCAGTTTGGACGGCAGGATAATAGCTAAGAAATGTGACTCCACCTCGGTGGTGTGTTATAGTCTTGGTTGATACTGCCTGTCTAGACTGAGGACTGCGTCTTTGACTAGGATGCT

Name of Depositor NRRL
Chain of Custody
ATCC <<--NRRL<<--CBS 615 <<--- E.C. Holst
Isolation
bark-beetle, USA
Cross References

Complete Genome (GenBank) : AEIM00000000 Candida tenuis ATCC 10573, whole genome shotgun sequencing project

References

Diddens HA, Lodder J. Die anaskosporogenen Hefen, zweite Halfte. Amsterdam: North-Holland; 1942.

Wohlbach DJ, et al. Comparative genomics of xylose-fermenting fungi for enhanced biofuel production. Proc. Natl. Acad. Sci. USA 108: 13212-13217, 2011. PubMed: 21788494

Diddens HA, Lodder J. Die anaskosporogenen Hefen, zweite Halfte. Amsterdam: North-Holland; 1942.

Permits Notice: Necessary Permits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation