Aspergillus alabamensis Balajee et al. (ATCC® MYA-3633)

Strain Designations: AT2  /  Product Format: frozen

Deposited As Aspergillus terreus
Strain Designations AT2
Application
Antifungal susceptibility testing
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Comments The strain was re-identified as Aspergillus alabamensis, a close sister of Aspergillus terreus, based on the multigene sequence analysis. This change does not affect to its use as quality control strain for standard tests.
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

GGTTTCCGTAGGTGAACCTGCGGAAGGATCATTACCGAGTGCGGGTCTTTATGGCCCAACCTCCCACCCGTGACTATTGTACCTTGTTGCTTCGGCGGGCCCGCCAGCGTTGCTGGCCGCCGGGGGGCGACTCGCCCCCGGGCCCGTGCCCGCCGGAGACCCCAACATGAACCCTGTTCTGAAAGCTTGCAGTCTGAGTGTGATTCTTTGCAATCAGTTAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAACTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCCCGGCTTGTGTGTTGGGCCCTCGTCCCCCGGCTCCCGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGGTCCTCGAGCGTATGGGGCTTCGTCTTCCGCTCCGTAGGCCCGGCCGGCGCCTGCCGACGCAATTTTTTTGCAACTTGTTTTTTTCCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAA


D1D2 region of the 28S ribosomal RNA gene

ATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAAGAGCTCAAATTTGAAAGCTGGCTCCTTCGGGGTCCGCATTGTAATTTGCAGAGGATGCTTCGGGTGCAGCCCCCGTCTAAGTGCCCTGGAACGGGCCGTCATAGAGGGTGAGAATCCCGTATGGGGCGGGGTGTCTGCGTCCGTGTGAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATACTGGCCGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTCGCTCGCGGGGTTCAGCCGGGCTTCGGCCCGGTGTACTTCCCCGCGGGCGGGCCAGCGTCGGTTTGGGCGGCCGGTCAAAGGCCTCCGGAATGTAGCGCCCTTCGGGGCGCCTTATAGCCGGGGGTGCAATGCGGCCAGCCTGGACCGAGGAACGCGCTTCGGCACGGACGCTGGCATAATGGTTGTAAAC


beta-tubulin (TUB2) gene

TGTGCCCGATCCCCCTGTTCCCCTCTCCCCCCGACGCGTCTCTTTTGGGCTGCTCTCTGAAGACCAACCCCACCCGTTCCTGGAGAAACTTTGGATGAATTGACTAACATTCTTTCTTCTTCGTGATCATAGGTTCATCTGCAAACCGGCCAGTGTGTAAGTGCGATCGTGTCCTTTCGATGAGGATGGGGATGAGATGTTTTGTGACAGAGACTGAAACGGGTGGTGATAGGGTAACCAAATTGGTGCCGCTTTCTGGTACGTCTGGAATCAACCTGGGGAATGCTGGCTCTCGCGGAACGCAGAGTCTTATGGACATGCGTTCTCGGGCTAGGAAAGGTTCTGTGGTGGCGTGATTCTGACAACCTGTACAGGCAAACCATCTCTGGCGAGCACGGCCTTGATGGCTCCGGTGTGTAAGTGTCTCCGACGCCCGCTCAATGGGCTCCCATAATGGAGAATTACACGACAATGGACGATTCTGATGGAAGAACAGCTTCAATGGCTCCTCCGACCTCCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTACGTCCACTCCCACACCATCTTATAACAGACTCTCCACACTCCAATGACCTCGACACTAATTTCCACCCCCTATAGGCCAGCGGAAACAAGTATGTTCCTCGTGCCGTCCTCGTTGACCTTGAGCCCGGTACCATGGACGCCGTCCGTGCCGGTCCCTTCGGTCAGCTCTTCCGTCCCGACAACTTCGTCTTCGGCCAGTCTGGTGCCGGTAACAACTGG

Name of Depositor TJ Walsh
Special Collection NSF - Mycology
Chain of Custody
ATCC <-- T J Walsh
Isolation
human
Cross References

Nucleotide (GenBank) : KU933439 ITS including 5.8S rRNA gene

Nucleotide (GenBank) : KU933413 D1/D2 region of 28S rRNA gene

Nucleotide (GenBank) : KU897016 beta-tubulin (TUB2) gene

References

Reference Method for Broth Dilution Antifungal Susceptibility Testing of Filamentous Fungi: Approved Standard - 2nd Edition. Wayne, PA. Clinical and Laboratory Standards Institute; CLSI M38-A2.

Espinel-Ingroff A, et al. Quality control and reference guidelines for CLSI broth microdilution susceptibility method (M38-A document) for amphotericin B, itraconazole, posaconazole, and voriconazole. J. Clin. Microbiol. 43: 5243-5246, 2005.

Ghannoum MA, et al. Interlaboratory study of quality control isolates for a broth microdilution method (modified CLSI M38-A) for testing susceptibilities of dermatophytes to antifungals. J. Clin. Microbiol. 44: 4353-4356, 2006.