Candida albicans (Robin) Berkhout (ATCC® 28121)

Strain Designations: 304  /  Product Format: freeze-dried

Permits and Restrictions

View Permits

Deposited As Candida albicans (Robin) Berkhout, anamorph
Strain Designations 304
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format freeze-dried
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Comments
Effect in guinea pig leucocytes
Morphology Colonies are white to cream-colored, butyrous to membranous, entire to erose margins. Cells globose-ovoid-ellipsoid, reproducing by budding. Pseudohyphae present.
Medium ATCC® Medium 200: YM agar or YM broth
ATCC® Medium 1245: YEPD
Growth Conditions
Temperature: 20°C to 25°C
Atmosphere: Typical aerobic
Sequenced Data
D1D2 region of the 28S ribosomal RNA gene:

AACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTCAGTAGCGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCGTCTTTGGCGTCCGAGTTGTAATTTGAAGAAGGTATCTTTGGGCCCGGCTCTTGTCTATGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTGCGATGAGATGACCCGGGTCTGTGTAAAGTTCCTTTGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGCTTGAGATCAGACTTGGTATTTTGCATGCTGCTCTCTCGGGGGCGGCCGCTGCGGTTTACCGGGCCAGCATCGGTTTGGAGCGGCAGGATAATGGCGGAGGAATGTGGCACGGCTTCTGCTGTGTGTTATAGCCTCTGACGATACTGCCAGCCTAGACCGAGGACTGCGGTTTTTTTACCTAGGATGTTGGCATAATGATCTTAAGTCGCCCGTCTTGAAA

Morphology Colonies are white to cream-colored, butyrous to membranous, entire to erose margins. Cells globose-ovoid-ellipsoid, reproducing by budding. Pseudohyphae present.
Name of Depositor DH Howard
Isolation
feces, California
References

Howard DH. Fate of Histoplasma capsulatum in guinea pig polymorphonuclear leukocytes. Infect. Immun. 8: 412-419, 1973. PubMed: 4125783

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation
Other Documentation