Candida albicans (Robin) Berkhout, anamorph (ATCC® 11651)

Strain Designations: 171D  /  Product Format: freeze-dried

Strain Designations 171D
Biosafety Level 1
Product Format freeze-dried
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Comments
Effects of yeast cells on virulence for mice
Morphology and physiology of strain sectors
response to light
Morphology Colonies on YM agar at 25°C after 5 days cream-coloured, smooth, dull, dome-shaped, with a mycelial border. Yeast like cells globose to ovoidal, thin walled, hyaline and occur single in pairs and clusters.
Medium ATCC® Medium 200: YM agar or YM broth
ATCC® Medium 1245: YEPD
Growth Conditions
Temperature: 24°C to 26°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

TCCGTAGGTGAACCTGCGGAAGGATCATTACTGATTTGCTTAATTGCACCACATGTGTTTTTCTTTGAAACAAACTTGCTTTGGCGGTGGGCCCAGCCTGCCGCCAGAGGTCTAAACTTACAACCAATTTTTTATCAACTTGTCACACCAGATTATTACTAATAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATATGAATTGCAGATATTCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTCTGGTATTCCGGAGGGCATGCCTGTTTGAGCGTCGTTTCTCCCTCAAACCGCTGGGTTTGGTGTTGAGCAATACGACTTGGGTTTGCTTGAAAGACGGTAGTGGTAAGGCGGGATCGCTTTGACAATGGCTTAGGTCTAACCAAAAACATTGCTTGCGGCGGCAACGTCTACCACGTATATCTTCAAACTTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAG


D1D2 region of the 28S ribosomal RNA gene

CATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTCAGTAGCGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCGTCTTTGGCGTCCGAGTTGTAATTTGAAGAAGGTATCTTTGGGCCCGGCTCTTGTCTATGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTGCGATGAGATGACCCGGGTCTGTGTAAAGTTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGCTTGAGATCAGACTTGGTATTTTGCATGCTGCTCTCTCGGGGGCGGCCGCTGCGGTTTACCGGGCCAGCATCGGTTTGGAGCGGCAGGATAATGGCGGAGGAATGTGGCACGGCTTCTGCTGTGTGTTATAGCCTCTGACGATACTGCCAGCCTAGACCGAGGACTGCGGTTTTTACCTAGGATGTTGGCATAATGATCTTAAGTCGC

Morphology Colonies on YM agar at 25°C after 5 days cream-coloured, smooth, dull, dome-shaped, with a mycelial border. Yeast like cells globose to ovoidal, thin walled, hyaline and occur single in pairs and clusters.
Name of Depositor GH Scherr
Chain of Custody
ATCC <-- GH Scherr <-- M. Hotchkiss <-- F. Spindle
Isolation
lung pus, Virginia
Cross References

Nucleotide (GenBank) : J04230 C.albicans thymidylate synthase (Ts) gene, complete cds.

References

. . Mycopathol. Mycol. Appl. 6: 260-289, 1953.

Saltarelli CG, Coppola CP. Effect of light on growth and metabolite synthesis in Candida albicans. Mycologia 71: 773-785, 1979.

Saltarelli CG. Morphological and physiological variations between sectors isolated from giant colonies of Candida albicans and C. stellatoidea. Mycopathol. Mycol. Appl. 34: 209-220, 1968.