Candida viswanathii Sandhu et Randhawa, anamorph (ATCC® 20962)

Strain Designations: H5343  /  Product Format: freeze-dried

Permits and Restrictions

View Permits

Deposited As Candida tropicalis (Castellani) Berkhout, anamorph
Strain Designations H5343
Application
Produces dicarboxylic acids
Biosafety Level 1
Product Format freeze-dried
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Genotype pox5:ura3A pox5:ura3A pox4A:ura3A pox4B:URA3A
Preceptrol® no
Comments
Cannot utilize dodecane or methyl laurate as sole carbon source for growth.
Morphology On YM medium at 25°C after 3 days, colonies creamy white to dingy white, raised, dull, margin entire becoming filamentous with age. Cells subglobose to broadly ellipsoidal, smooth, guttulate, small cells 6.8-8.3 X 3.8-6.0 µm, large cells 13.5-15.0 X 6.8 µm. Pseudohyphae present.
Medium ATCC® Medium 200: YM agar or YM broth
ATCC® Medium 1245: YEPD
Growth Conditions
Temperature: 20°C to 25°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence:

GGGGGGACTCGTTTCCGCCGCCAGAGGTCACAACTAAACCAAACTTTTTATTACCAGTCAACCATACGTTTTAATAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAGTATGAATTGCAGATATTCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTTGAGCGTCATTTCTCCCTCAAGCCCGCGGGTTTGGTGTTGAGCAATACGCCAGGTTTGTTTGAAAGACGTACGTGGAGACTATATTAGCGACTTAGGTTCTACCAAAACGCTTGTGCAGTCGGCCCACCACAGCTTTTCTAACTTTTGACCTC


D1D2 region of the 26S ribosomal RNA gene:

ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTTAGTAGCGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCTCTTTCAGAGTCCGAGTTGTAATTTGAAGAAGGTATCTTTGGGCCTGGCTCTTGTCTATGTTTCTTGGAACAGAACGTCACAGAGGGTGAGAATCCCGTGCGATGAGATGACCCAGGTCCGTGTAAAGTTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGCTTGAGATCAGACTTGGCATTTTGCATGTTGCTTCTTCGGGGGCGGCCTCTGCGGTTTGTCGGGCCAGCATCAGTTTGGGCGG

Morphology On YM medium at 25°C after 3 days, colonies creamy white to dingy white, raised, dull, margin entire becoming filamentous with age. Cells subglobose to broadly ellipsoidal, smooth, guttulate, small cells 6.8-8.3 X 3.8-6.0 µm, large cells 13.5-15.0 X 6.8 µm. Pseudohyphae present.
Name of Depositor Henkel Research Corp.
Special Collection NCRR Contract
Isolation
derived from ATCC 20913
References

Picataggio S, et al. Site-specific modification of the Candida tropicalis genome. US Patent 5,254,466 dated Oct 19 1993

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation