Trametes versicolor (Linnaeus : Fries) Lloyd, teleomorph (ATCC® 200801)

Strain Designations: 13-2336  /  Product Format: frozen

Permits and Restrictions

View Permits

Deposited As Trametes versicolor (Linnaeus : Fries) Pilat, teleomorph
Strain Designations 13-2336
Application
degrades olive-mill wastewater
degrades vinasse
produces abscisic acid
produces gibberellic acid GA3, gibberellin A3
produces indoleacetic acid
produces single-cell protein SCP
produces zeatin
decolorizes: crystal violet
produces single-cell protein from vinasse
decolorization, phenol removal, and production of single-cell protein from olive mill wastes
Biosafety Level 1
Product Format frozen
Type Strain no
Preceptrol® no
Medium ATCC® Medium 323: Malt agar medium
Growth Conditions
Temperature: 30.0°C
Sequenced Data
       18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence.

ACGAGTTTTGAAACGAGTTGTAGCTGGCCTTCCGAGGCATGTGCACGCTCTGCTCATCCACTCTACCCCTGTGCACTTACTGTAGGTTGGCGTGGGCTCCTTAACGGGAGCATTCTGCCGGCCTATGTATACTACAAACACTTTAAAGTATCAGAATGTAAACGCGTCTAACGCATCTATAATACAACTTTTAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGGAATTCTCAACTTATAAATCCTTGTGATCTATAAGCTTGGACTTGGAGGCTTGCTGGCCCTCGTTGGTCGGCTCCTCTTGAATGCATTAGCTCGATTCCGTACGGATCGGCTCTCAGTGTGATAATTGTCTACGCTGTGACCGTGAAGTGTTTTGGCGAGCTTCTAACCGTCCATTAGGACAACTTTTTAACATCTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATC

Name of Depositor O Yesilada
Isolation
Cupressus sp., Adana, Turkey
Cross References

Nucleotide (GenBank) : GU256761 ITS including 5.8S rRNA gene

References

Yesilada O. Decolourization of crystal violet by fungi. World J. Microbiol. Biotechnol. 11: 601-602, 1995.

Fiskin K, Yesilada O. The use of white rot fungi for evaluation and degradation of vinasse. Turk. J. Biol. 19: 181-189, 1995.

Fiskin K, Yesilada O. Degradation of olive mill waste by Coriolus versicolor. Turk. J. Biol. 20: 73-79, 1996.

Yesilada O, et al. Biodegradation of olive oil mill wastewater by Coriolus versicolor and Funalia trogii: effects of agitation, initial COD concentration, inoculum size and immobilization. World J. Microbiol. Biotechnol. 14: 37-42, 1998.

Yurekli F, et al. Plant growth hormone production from olive oil mill and alcohol factory wastewaters by white rot fungi. World J. Microbiol. Biotechnol. 15: 503-505, 1999.

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
  • USDA APHIS PPQ Permit 526, plant pathogens permit must be obtained and a copy of the permit must be sent to ATCC in advance of shipment. Isolation information for this item is required by USDA. Please check our website or contact Technical Service for assistance. Domestic isolates are easier to obtain than foreign isolates.
Basic Documentation