Yarrowia lipolytica (Wickerham et al.) van der Walt et von Arx, teleomorph (ATCC® 15586)

Alternate State: Candida lipolytica (Harrison) Diddens et Lodder, anamorph  /  Strain Designations: M6  /  Product Format: freeze-dried

Permits and Restrictions

View Permits

Deposited As Torulopsis famata Harrison, anamorph
Strain Designations M6
Alternate State Candida lipolytica (Harrison) Diddens et Lodder, anamorph
Application
Produces citric acid citrate
Produces isocitric acid isocitrate
Biosafety Level 1
Product Format freeze-dried
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Medium Medium 28: Emmons' modification of Sabouraud's agar
Medium 200: YM agar or YM broth
Medium 336: Potato dextrose agar (PDA)
Growth Conditions
Temperature: 24°C to 26°C
Atmosphere: Typical aerobic
Sequenced Data
D1D2 region of the 26S ribosomal RNA gene

ATTGCCTCAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAACCCTCGGGATTGTAATTTGAAGATTTGGCATTGGAGAAAGCTAACCCAAGTTGCTTGGAATAGTACGTCATAGAGGGTGACAACCCCGTCTGGCTAACCGTTCTCCATGTATTGCCTTATCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAGTGGGTGGTAAACTCCATCTAAAGCTAAATACTGGTGAGAGACCGATAGCGAACAAGTACTGTGAAGGAAAGGTGAAAAGAACTTTGAAAAGAGAGTGAAATAGTATGTGAAATTGTTGATAGGGAAGGAAATGAGTGGAGAGTGGCCGAGGTTTCAGCCGCCCCTCGTGGGCGGTGTACTGCCGACGCCGAGTCATCGATAGCGAGACGAGGGTTACAAATGGGAGCGCCTT

Name of Depositor Kyowa Ferm. Ind. Co., Ltd.
Isolation
Sewage
References

Kimura K, Nakanishi T. Production of citric acid, isocitric acid, and microbial cells by fermentation. US Patent 3,873,424 dated Mar 25 1975

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation