Zygosaccharomyces rouxii (Boutroux) Yarrow, teleomorph (ATCC® 14679)

Alternate State: Candida mogii Vidal-Leiria, anamorph, Candida placentae Goto, anamorph  /  Strain Designations: NRRL Y-2547 [CBS 4837, CCRC 21487, DSM 2531, IFO 1876, NCYC 751]  /  Product Format: freeze-dried

Permits and Restrictions

View Permits

Deposited As Saccharomyces rouxii Boutroux, teleomorph
Strain Designations NRRL Y-2547 [CBS 4837, CCRC 21487, DSM 2531, IFO 1876, NCYC 751]
Alternate State Candida mogii Vidal-Leiria, anamorph, Candida placentae Goto, anamorph
Application
Produces miso
Transformation host
Biosafety Level 1
Product Format freeze-dried
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Mating Type mating type a RefOshio K, et al. Construction of a host-vector system in the osmophilic haploid yeast Zygosaccharomyces rouxii. J. Ferment. Technol. 66: 481-488, 1988.
Comments
Devoid of any plasmids
Miso fermentation
Medium Medium 28: Emmons' modification of Sabouraud's agar
Medium 200: YM agar or YM broth
Medium 336: Potato dextrose agar (PDA)
Growth Conditions
Temperature: 24°C to 26°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

GGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATAGAAAATGACGTGAACTCTTAACGGAGTTCTCTCAAAGTGTTGGAGGGGAAGGCCTGCGCTTAATTGCGCGGCTGTTTTTAATCTCCTCCGCCTTTGATACACACATTGGAGTTTCTACTTTTTTGTTCTCTTTGGGAGGGTTCTGCTCTCCCAGAGGTAAACACAAACAATCTTTTATTATACTATTAACACAGTCAAATGAATTTTAAAAACAAAATATTCAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAACTGCGATACGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGGGGGGCATGCCTGTTTGAGCGTCATTTCCCTCTCAAACTTTACGTTTGGTAGTGAGCGATACTCTACTCTGGAGTTTGCTTGAAAATGGGAGGCCATAGGCGGAGCTTAGTTTGCGACTGTGCCGAGAGGCATGGGAGCGGCCTAGCCACGAAAAGTCGTATTAGGTTTTACCGACTCGGCGGAATAGTGGAGAGGTTTCTTTTTTTTTTATTCTAAGGTAAGCCGTCTGGCTAGACAAAATTCTCAAAGTTTGACCTCAAATCAGGTAGGATTACCCGCTGAACTTAAGCATATCAATAA


D1D2 region of the 26S ribosomal RNA gene

ATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGTACCTTTCGGTGCCCGAGTTGTAATTTGGAGAGAGTGATTCTGGGACTGGCCCTTGCCTATGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAACCCCGTGAGGCGAGGTGATCCAGTTCTTTGTAGAGCGCTCTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGAGGGTGGTAAATTCCATCTAAAGCTAAATACAGGCGAGAGACCGATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGGACGTGAAATTGTTGAAAGGGAAGGGCATTTGATCAGACATGGTGTTTTGTGCCCCTCGCTCCTCGTGGGTGGGGGAATCTCGCAGCTCACTGGGCCAGCATCAGTTTTGGCGGCAGGAGAAATCCTCGGGAATGTGGCTCTTGCCTCTGGTAGGAGTGTTATAGCCCGGGGGAATACTGCCAGCTGGGACTGAGGTATGCGACATTTTGTCAAGGATGTTGGCATAATGGTTATATGCCGC

Name of Depositor NRRL
Isolation
Japanese miso
References

Smith AK, et al. Preparation of miso. US Patent 2,967,108 dated Jan 3 1961

Hesseltine CW. A millennium of fungi, food, and fermentation. Mycologia 57: 149-197, 1965.

Oshio K, et al. Construction of a host-vector system in the osmophilic haploid yeast Zygosaccharomyces rouxii. J. Ferment. Technol. 66: 481-488, 1988.

Solieri L, et al. Unravelling genomic diversity of Zygosaccharomyces rouxii complex with a link to its life cycle. FEMS Yeast Res.13: 245-258, 2013. PubMed: 23279556

Shepherd A, Piper PW. The Fps1p aquaglyceroporin facilitates the use of small aliphatic amides as a nitrogen source by amidase-expressing yeasts. FEMS Yeast Res.10: 527-534, 2010. PubMed: 20491941

Suezawa Y, Suzuki M, Mori H. Genotyping of a miso and soy sauce fermentation yeast, Zygosaccharomyces rouxii, based on sequence analysis of the partial 26S ribosomal RNA gene and two internal transcribed spacers. Biosci. Biotechnol. Biochem. 72: 2452-2455, 2008. PubMed: 18776675

James SA, et al. Molecular evidence for the existence of natural hybrids in the genus Zygosaccharomyces. FEMS Yeast Res. 5: 747-755, 2005. PubMed: 15851103

Oshio K, et al. Construction of a host-vector system in the osmophilic haploid yeast Zygosaccharomyces rouxii. J. Ferment. Technol. 66: 481-488, 1988.

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation