Candida jeffriesii Nguyen et al. (ATCC® MYA-4346)

Strain Designations: BG 02-6-6-1-10 [CBS 9898, NRRL Y-27738]  /  Product Format: frozen

Strain Designations BG 02-6-6-1-10 [CBS 9898, NRRL Y-27738]
Application
Ferments pentose (xylose).
Bioethanol production
Biosafety Level 1
Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain yes
Preceptrol® no
Comments
Insect associated yeast. Isolated from digestive tract of tropical beetle living in woody substrates.
Medium ATCC® Medium 28: Emmons' modification of Sabouraud's agar
ATCC® Medium 200: YM agar or YM broth
ATCC® Medium 1245: YEPD
Growth Conditions
Temperature: 24°C to 26°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

TTTCCGTAGGTGAACCTGCGGAAGGATCATTACTGTTTCTGCGCTTAATTGCGCGATCTACACACGATGTTTTTTATATCAACTTGCTTTGGTCTGGCGGTAGTCGGGCCAGAGGTAAACTCAACCAATATTTATTATTTGTCAACAACATACTAATGTTAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATATGAATTGCAGATATTCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTCTGGTATTCCGGAGGGCATGCCTGTTTGAGCGTCATTTCTCTCTCAAGCCCTCGGGTTTGGTGTTGAGTGATACTCCCAGTCAGACTCGGCGTTTTCTTGAAAGGCCTCGGCGTGAGCTACGACAATGTATTAGGTTCATCCAACTCGTTGTCAGCAGCGCACGCGCCCTTACAAATCAACCAAAGTTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGA


D1D2 region of the 26S ribosomal RNA gene

ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTTAGTAGCGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCAGTTTCACTGTCCGAGTTGTAATTTGAAGAAGGTATCTTTGGGTCTGGCGCTTGTCTATGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTGCGACGGGCTGCCCAGATCCGTGTAAAGTTCCTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGCATGCGATCAGACTTGGTATTTTGTATGTCTTGCTTTCGGGCGGGGCCTCTGCAGCTTACTGGGCCAGCATCGGTTCGGGTGGCAGGACAATTGCGGAGAAATGTGGCACGGCCTCGGTTGTGTGTTATAGTCTCTGTCGATACTGCCTGCCTGGACCGAGGACTGCGTCTTACGACTAGGATGCTGGCATAATGATCGTACGCCGCCCGTCTTG

Name of Depositor SO Suh
Special Collection ATCC
Chain of Custody
ATCC <-- SO Suh
Isolation
Gut of Phrenapates bennetti (Tenebrionidae), Chiriqui, Panama
Cross References

Nucleotide (GenBank) : FJ623615 ITS including 5.8S rRNA gene

Nucleotide (GenBank) : FJ614682 D1/D2 region of 28S rRNA gene

Nucleotide (GenBank) : KC507445 EF-1 alpha gene

Nucleotide (GenBank) : KC507414 RPB1 gene

Nucleotide (GenBank) : KC512840 RPB2 gene

References

Nguyen NH, et al. Morphological and ecological similarities: wood-boring beetles assoicated with novel xylose-fermenting yeasts, Spathaspora passalidarum gen. sp. nov. and Candida jeffriesii sp. nov. Mycol. Res. 110: 1232-1241, 2006.

Suh SO, et al. Scheffersomyces parashehatae f.a., sp. nov., Scheffersomyces xylosifermentans f.a., sp. nov., Candida broadrunensis sp. nov., and Candida manassasensis sp. nov., four novel yeasts associated with wood- ingesting insects and their ecological and biofuel implications. Int. J. Syst. Evol. Microbiol. 63: 4330-4339, 2013. PubMed: 24014624