Schizochytrium sp. (ATCC® 20888)

Strain Designations: S31  /  Product Format: frozen

Permits and Restrictions

View Permits

Classification KINGDOM: Chromista
Strain Designations S31
Application
Produces omega-3 fatty acids
Biofuel production
Biosafety Level 1
Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Medium Medium 790: By+ medium
Medium 534: Seawater with serum
Medium 662: Seawater medium
Growth Conditions
Temperature: 20°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA, partial sequence:

TGTAGTCATATGCTTGTCTCAAAGACTAAGCCATGCATGTGTAAGTATAAGCGAATTATACTGTGAAACTGCGAACGGCTCATTATATCAGTTATAATCCCTTCGGTAGTTCCTTTATACGGATACCTGCAGTAATTCTGGAATTAATACGTGCTGTACGGGCCCGACTTTCGGGGAGGGCCGCACTTATTAGGTCTAAGCCAACTCTCTTGGTGAGTCATGATAATTGAGCAGATCGCTTTTCGGAGCGATGAATCGTTTGAGTTTCTGCCCCATCAGTTGTCGACGGTAGGGTATTGGCCTACGGTGACTATAACGGGTGACGGGGAGTTAGGGCTCGACTCCGGAGAGGGAGCCTGAGAGACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGTAAATTACCCAATGTGGACTCCACGA

Name of Depositor OmegaTech, Inc.
Isolation
Estuarine water, California
References

Barclay WR. Process for the heterotrophic production of microbial products with high concentrations of omega-3 highly unsaturated fatty acids. US Patent 5,130,242 dated Jul 14 1992

Tsui CKM, et al. Labyrinthulomycetes phylogeny and its implications for the evolutionary loss of chloroplasts and gain of ectoplasmic gliding. Mol. Phylogenet. Evol. 2008. PubMed: 18977305

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation