Schizochytrium aggregatum Goldstein et Belsky (ATCC® 28209)

Strain Designations: 16  /  Product Format: frozen

Permits and Restrictions

View Permits

Classification KINGDOM: Chromista
Strain Designations 16
Application
Biofuel production
Biosafety Level 1
Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Genome Sequenced Strain

Yes

Comments
Genome sequencing strain (the Joint Genome Institute at the Department of Energy, USA).
Morphology After 6 days on BY+ medium at 20°C, colonies cream-colored, granular. Vegetative cells irregularly shaped, guttulate. Thalli and hyphae not observed.
Medium ATCC® Medium 790: By+ medium
Growth Conditions
Temperature: 20°C
Atmosphere: Typical aerobic
Sequenced Data
Partial 18S ribosomal RNA gene

CCTTAGATGTTCTGGGCCGCACGCGCGCTACACTGACTGGGGGAGCACGTTGCTTTGTCGTACGACAACGTCCTGGGCCGGAAGGTTTGGGTAATCGTGTGAATACCAGTCGTGATGGGGCTAGATCTTTGCAATTATTGATCTCCAACGAGGAATTCCTAGTAAACGCAAGTCATCAGCTTGCATTGATTACGTCCCTGCCCTTTGTACACACCGCCCGTCGCACCTACCGATTGAACGTTCCGGTGAGACCTTCGGAGGGCACGATGTTCCTGGCGACAGGACGTGGTGGCCAAAGTTGAGCAAACCTTAACGTTTAGAGGAAGGTGAAGTCGTAACAAGGTT

Morphology After 6 days on BY+ medium at 20°C, colonies cream-colored, granular. Vegetative cells irregularly shaped, guttulate. Thalli and hyphae not observed.
Name of Depositor DJ Alderman
Chain of Custody
ATCC <-- DJ Alderman <-- J Schneider
Isolation
seawater, West Germany
Cross References

Nucleotide (GenBank) : M13616 Schizochytrium aggregatum 5S rRNA.

Nucleotide (GenBank) : X06104 Schizochytorium aggregatum 5S ribosomal RNA.

References

Honda D, et al. Molecular phylogeny of labyrinthulids and thraustochytrids based on the sequencing of 18S ribosomal RNA gene. J. Eukaryot. Microbiol. 46: 637-647, 1999. PubMed: 10568038

Tsui CKM, et al. Labyrinthulomycetes phylogeny and its implications for the evolutionary loss of chloroplasts and gain of ectoplasmic gliding. Mol. Phylogenet. Evol. 2008. PubMed: 18977305

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation