Schizochytrium sp. (ATCC® 20889)

Strain Designations: S8  /  Product Format: frozen

Permits and Restrictions

View Permits

Classification KINGDOM: Chromista
Strain Designations S8
Application
Biofuel production
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Morphology After 4-5 days at 20°C on By+ medium colonies are smooth and pale pink in color. Thallus epibiotic and interbiotic, thin-walled, globose; tetrad-shaped, becoming an amorphous mass.
Medium ATCC® Medium 790: By+ medium
ATCC® Medium 534: Seawater with serum
ATCC® Medium 662: Seawater medium
Growth Conditions
Temperature: 20°C to 25°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence

CCCTTAGATGTTCTGGGCCGCACGCGCGCTACACTGATGGGTTCAACGGGTCTTTTCGCTGCTCGCAGCGAGTTGCTTTGCCGGAAGGCATGGCTAATCCTTTCAACGCTCATCGTGCTGGGGCTAGATTTTTGCAATTATTAATCTCCAACGAGGAATTCCTAGTAAACGCAAGTCATCAGCTTGCATTGAATACGTCCCTGCCCTTTGTACACACCGCCCGTCGCACCTACCGATTGAACGGTCCGATGAAACCATGGGATGACCTTTTGAGCGTTTATTCGCGATGGAGGTCAGAACTCGGGTGAATCTTATTGTTTAGAGGAAGGTGAAGTCGTAACAAGGTTT

Morphology After 4-5 days at 20°C on By+ medium colonies are smooth and pale pink in color. Thallus epibiotic and interbiotic, thin-walled, globose; tetrad-shaped, becoming an amorphous mass.
Name of Depositor OmegaTech, Inc.
U.S. Patent Number
Disclosure This material is cited in a US or other Patent and may not be used to infringe the claims. Depending on the wishes of the Depositor, ATCC may be required to inform the Patent Depositor of the party to which the material was furnished.
Isolation
seawater, California
Cross References

Nucleotide (GenBank) : KC146351 18S rRNA gene

References

Barclay WR. Process for the heterotrophic production of microbial products with high concentrations of omega-3 highly unsaturated fatty acids. US Patent 5,130,242 dated Jul 14 1992

Jakobsen AN, et al. Endogenously synthesized (-)-proto-quercitol and glycine betaine are principal compatible solutes of Schizochytrium sp. strain S8 (ATCC 20889) and three new isolates of phylogenetically related thraustochytrids. Appl. Environ. Microbiol. 73: 5848-5856, 2007. PubMed: 17660311

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation