Schizochytrium sp. (ATCC® 20889)

Strain Designations: S8  /  Product Format: frozen

Permits and Restrictions

View Permits

Classification KINGDOM: Chromista
Strain Designations S8
Application
Biofuel production
Biosafety Level 1
Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Morphology After 4-5 days at 20°C on By+ medium colonies are smooth and pale pink in color. Thallus epibiotic and interbiotic, thin-walled, globose; tetrad-shaped, becoming an amorphous mass.
Medium ATCC® Medium 790: By+ medium
ATCC® Medium 534: Seawater with serum
ATCC® Medium 662: Seawater medium
Growth Conditions
Temperature: 20°C to 25°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence

CCCTTAGATGTTCTGGGCCGCACGCGCGCTACACTGATGGGTTCAACGGGTCTTTTCGCTGCTCGCAGCGAGTTGCTTTGCCGGAAGGCATGGCTAATCCTTTCAACGCTCATCGTGCTGGGGCTAGATTTTTGCAATTATTAATCTCCAACGAGGAATTCCTAGTAAACGCAAGTCATCAGCTTGCATTGAATACGTCCCTGCCCTTTGTACACACCGCCCGTCGCACCTACCGATTGAACGGTCCGATGAAACCATGGGATGACCTTTTGAGCGTTTATTCGCGATGGAGGTCAGAACTCGGGTGAATCTTATTGTTTAGAGGAAGGTGAAGTCGTAACAAGGTTT

Morphology After 4-5 days at 20°C on By+ medium colonies are smooth and pale pink in color. Thallus epibiotic and interbiotic, thin-walled, globose; tetrad-shaped, becoming an amorphous mass.
Name of Depositor OmegaTech, Inc.
Isolation
seawater, California
Cross References

Nucleotide (GenBank) : KC146351 18S rRNA gene

References

Barclay WR. Process for the heterotrophic production of microbial products with high concentrations of omega-3 highly unsaturated fatty acids. US Patent 5,130,242 dated Jul 14 1992

Jakobsen AN, et al. Endogenously synthesized (-)-proto-quercitol and glycine betaine are principal compatible solutes of Schizochytrium sp. strain S8 (ATCC 20889) and three new isolates of phylogenetically related thraustochytrids. Appl. Environ. Microbiol. 73: 5848-5856, 2007. PubMed: 17660311

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation