Geosmithia morbida (ATCC® MYA-4903)

Strain Designations: GM-30-47TDFJH001  /  Product Format: frozen

Classification Ascomycota, Hypocreales, Bionectriaceae
Strain Designations GM-30-47TDFJH001
Biosafety Level 1
Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Genotype Not available
Preceptrol® no
Comments Plant pathogen
Morphology On PDA medium at 25°C after 16 days, colonies brown with tan margin, covered in moderately dense layer of white cottony mycelium, deeply lobbed margin, turns media bright yellow. Reverse dark reddish brown with tan margin. Hyphae guttulate. Conidiophores branched, verrucose, biverticillate to triverticillate. Conidia ovoid, smooth, 7.5-10.5 x 3.75-4.5 µm.
Medium ATCC® Medium 200: YM agar or YM broth
ATCC® Medium 324: Malt extract agar
ATCC® Medium 336: Potato dextrose agar (PDA)
Growth Conditions Temperature: 20°C to 25°C
Atmospheric: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence; GenBank number KC113640:

AGGGATCATTATCGAGTTACCAACTCCAAACCTTTGTGAACCTTACCACAGTTGCTTCGGCGGCCCCGCCCCGGGCGCCTCGGGATCCCCCCCCTAGGGGGCCCCGCGGGCGACCCGGACCCAGGCGACCGCCGGGGGACCCAAACTCTTGTCTTTTAGTGTATTATCTGAGTGGCATAAGCAAATAAATTAAAACTTTCAGCAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTACTCTGGCGGGCATGCCTGTCCGAGCGTCATTTCAACCCTCAGCACCCCCGTTCGCGGCGGGAGCTGGCGTTGGGGATCGGCCGTCCTCTGCGGCGGCCGGCCCCGAAACGAAGTGGCGGTCACGTCGCGACCTCCTCTGCGTAGTAGCAATATCTCGCAGCCTGGATAGCGGCGCGGCCACGCCGTAAAACCCCAACTATACCAAGGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAA

Morphology On PDA medium at 25°C after 16 days, colonies brown with tan margin, covered in moderately dense layer of white cottony mycelium, deeply lobbed margin, turns media bright yellow. Reverse dark reddish brown with tan margin. Hyphae guttulate. Conidiophores branched, verrucose, biverticillate to triverticillate. Conidia ovoid, smooth, 7.5-10.5 x 3.75-4.5 µm.
Name of Depositor D. Hadziabdic
Chain of Custody ATCC <-- D. Hadziabdic; University of Tennessee <-- L. Vito; Culture Maintance <-- M. Windham; Collector
Isolation Juglans nigra, Knox County, TN, USA.
Cross References

Nucleotide (GenBank) : KC113640 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

References

Hadziabdic D, et al. Development and characterization of sixteen microsatellite loci for Geosmithia morbida, the causal agent of thousand canker disease in black walnut (Juglans nigra). Conservation Genet. Res. 4(2): 287-289, 2012.