Verticillium dahliae Klebahn (ATCC® MYA-4575)

Strain Designations: Ls17 [VdLs17, FGSC 10137]  /  Product Format: frozen

Permits and Restrictions

View Permits

Strain Designations Ls17 [VdLs17, FGSC 10137]
Biosafety Level 1
Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Genome Sequenced Strain

Yes

Comments
Plant pathogen.
Genome sequencing strain (Broad Institute, USA).
Medium Medium 28: Emmons' modification of Sabouraud's agar
Medium 307: Cornmeal agar
Medium 336: Potato dextrose agar (PDA)
Growth Conditions
Temperature: 25°C
Atmosphere: Typical aerobic
Sequenced Data
ITS DNA sequence of MYA-4575 lot 58606951

TGAACCAGCGGAGGGATCATTACCGAGTATCTACTCATAACCCTTTGTGAACCATATTGTTGCTTCGGCGGCTCGTTCTGCGAGCCCGCCGGTCCATCAGTCTCTCTGTTTATACCAACGATACTTCTGAGTGTTCTTAGCGAACTATTAAAACTTTTAACAACGGATCTCTTGGCTCTAGCATCGATGAAGAACGCAGCGAAACGCGATATGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATGGCGCCTTCCAGTATCCTGGGAGGCATGCCTGTCCGAGCGTCGTTTCAACCCTCGAGCCCCAGTGGCCCGGTGTTGGGGATCTACGTCTGTAGGCCCTTAAAAGCAGTGGCGGACCCGCGTGGCCCTTCCTTGCGTAGTAGTTACAGCTCGCATCGGAGTCCCGCAGGCGCTTGCCTCTAAACCCCCTACAAGCCCGCCTCGTGCGGCAACGGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATA

Name of Depositor KV Subbarao
Special Collection ATCC
Chain of Custody
ATCC <-- KV Subbarao
Isolation
Lettuce (Lactuca sativa), Watsonville, CA, USA.
Cross References

Nucleotide (GenBank) : GU291257 ITS including 5.8S rRNA gene

References

Qin QM, et al. Phylogenetic analyses of phytopathogenic isolates of Verticillium spp. Phytopathology 96: 582-592, 2006.

Wang H, et al. A fungal phylogeny based on 82 complete genomes using the composition vector method. BMC Evol. Biol. 9: 195, 2009.

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
  • USDA APHIS PPQ Permit 526, plant pathogens permit must be obtained and a copy of the permit must be sent to ATCC in advance of shipment. Isolation information for this item is required by USDA. Please check our website or contact Technical Service for assistance. Domestic isolates are easier to obtain than foreign isolates.
Basic Documentation