Verticillium dahliae Klebahn (ATCC® MYA-4575)

Strain Designations: Ls17 [VdLs17, FGSC 10137]  /  Product Format: frozen

Strain Designations Ls17 [VdLs17, FGSC 10137]
Biosafety Level 1
Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Genome Sequenced Strain

Yes

Comments
Plant pathogen.
Genome sequencing strain (Broad Institute, USA).
Sequenced Data
ITS DNA sequence of MYA-4575 lot 58606951

TGAACCAGCGGAGGGATCATTACCGAGTATCTACTCATAACCCTTTGTGAACCATATTGTTGCTTCGGCGGCTCGTTCTGCGAGCCCGCCGGTCCATCAGTCTCTCTGTTTATACCAACGATACTTCTGAGTGTTCTTAGCGAACTATTAAAACTTTTAACAACGGATCTCTTGGCTCTAGCATCGATGAAGAACGCAGCGAAACGCGATATGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATGGCGCCTTCCAGTATCCTGGGAGGCATGCCTGTCCGAGCGTCGTTTCAACCCTCGAGCCCCAGTGGCCCGGTGTTGGGGATCTACGTCTGTAGGCCCTTAAAAGCAGTGGCGGACCCGCGTGGCCCTTCCTTGCGTAGTAGTTACAGCTCGCATCGGAGTCCCGCAGGCGCTTGCCTCTAAACCCCCTACAAGCCCGCCTCGTGCGGCAACGGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATA

Name of Depositor KV Subbarao
Special Collection ATCC
Chain of Custody
ATCC <-- KV Subbarao
Isolation
Lettuce (Lactuca sativa), Watsonville, CA, USA.
Cross References

Nucleotide (GenBank) : GU291257 ITS including 5.8S rRNA gene

References

Qin QM, et al. Phylogenetic analyses of phytopathogenic isolates of Verticillium spp. Phytopathology 96: 582-592, 2006.

Wang H, et al. A fungal phylogeny based on 82 complete genomes using the composition vector method. BMC Evol. Biol. 9: 195, 2009.