Flammulina velutipes (Curtis : Fries) Singer, teleomorph (ATCC® 34574)

Strain Designations: SN-2 [N-1432]  /  Product Format: frozen

Permits and Restrictions

View Permits

Deposited As Gremmeniella abietina (Lagerberg) Morlet
Strain Designations SN-2 [N-1432]
Biosafety Level 1
Product Format frozen
Type Strain no
Preceptrol® no
Comments Plant pathogen
The species identity was confirmed by ITS sequence.
Medium Medium 324: Malt extract agar
Medium 336: Potato dextrose agar (PDA)
Medium 343: V8 juice agar
Growth Conditions
Temperature: 15°C to 20°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

GGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAATGAACTTTGAACTGCTTGTGGCTCTTGGGCTGTTGCTGACGAGGACCTTCACGGGTTCTTCGTACGTGCACGTCTGGGGTTGCAGCTTTCTTCGTCCACCTGTGCACACTCTGTAGGTCTGGATACCCCATTGGAAGGGTGCGCTTTTTGCGCTCCCTTTGCCTTCCAGGCCTATGTCTTACAAACACTATAGTATGTAACGAATGTCATTGATTATTGGACTTCACTGTCCTTTAAACTAAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAACTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACCTTGCGCCCTTTGGTACTCCGAAGGGCATGCCTGTTTGAGTGTCAGTAACTTCTCAACCTCCCTCACTTTGTTGTGAGCTGGCGGATTGGATGTGGGGGCTTGCTGGACCTTATCTTTGGGTTCAGCTCCCCTGAAATGCATTAGCAGAAACCGTTACCTTTTGGCGCGCTGCAGCTGTGATAATTATCTACGGCTATGGCTGGGCTGACTGTGTTGTAGCGCTCGTCTCGTCTCTGAAGTGGTTTCGCCTTAGTTGGTGCTTCCCTTTGCCTTCTCTCTCACGAGAGATACCTGTGACGCGAGTGCGCGGGCTATTCCGCTTCTAACCGTCCCCTTGTGGGACAAACTATTGACCATTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAA

Name of Depositor CE Dorworth
Chain of Custody
ATCC <-- CE Dorworth <-- F Roll-Hansen N-1432
Isolation
Picea abies, Norway
References

Dorworth CE, Krywienczyk J. Comparisons among isolates of Gremmeniella abietina by means of growth rate, conidia measurement, and immunogenic reaction. Can. J. Bot. 53: 2506-2525, 1975.

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
  • USDA APHIS PPQ Permit 526, plant pathogens permit must be obtained and a copy of the permit must be sent to ATCC in advance of shipment. Isolation information for this item is required by USDA. Please check our website or contact Technical Service for assistance. Domestic isolates are easier to obtain than foreign isolates.
Basic Documentation