Flammulina velutipes (Curtis : Fries) Singer, teleomorph (ATCC® 34574)

Strain Designations: SN-2 [N-1432]  /  Product Format: frozen

Deposited As Gremmeniella abietina (Lagerberg) Morlet
Strain Designations SN-2 [N-1432]
Biosafety Level 1
Product Format frozen
Type Strain no
Preceptrol® no
Comments Plant pathogen
The species identity was confirmed by ITS sequence.
Medium ATCC® Medium 324: Malt extract agar
ATCC® Medium 336: Potato dextrose agar (PDA)
ATCC® Medium 343: V8 juice agar
Growth Conditions
Temperature: 15°C to 20°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

GGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAATGAACTTTGAACTGCTTGTGGCTCTTGGGCTGTTGCTGACGAGGACCTTCACGGGTTCTTCGTACGTGCACGTCTGGGGTTGCAGCTTTCTTCGTCCACCTGTGCACACTCTGTAGGTCTGGATACCCCATTGGAAGGGTGCGCTTTTTGCGCTCCCTTTGCCTTCCAGGCCTATGTCTTACAAACACTATAGTATGTAACGAATGTCATTGATTATTGGACTTCACTGTCCTTTAAACTAAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAACTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACCTTGCGCCCTTTGGTACTCCGAAGGGCATGCCTGTTTGAGTGTCAGTAACTTCTCAACCTCCCTCACTTTGTTGTGAGCTGGCGGATTGGATGTGGGGGCTTGCTGGACCTTATCTTTGGGTTCAGCTCCCCTGAAATGCATTAGCAGAAACCGTTACCTTTTGGCGCGCTGCAGCTGTGATAATTATCTACGGCTATGGCTGGGCTGACTGTGTTGTAGCGCTCGTCTCGTCTCTGAAGTGGTTTCGCCTTAGTTGGTGCTTCCCTTTGCCTTCTCTCTCACGAGAGATACCTGTGACGCGAGTGCGCGGGCTATTCCGCTTCTAACCGTCCCCTTGTGGGACAAACTATTGACCATTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAA

Name of Depositor CE Dorworth
Chain of Custody
ATCC <-- CE Dorworth <-- F Roll-Hansen N-1432
Isolation
Picea abies, Norway
References

Dorworth CE, Krywienczyk J. Comparisons among isolates of Gremmeniella abietina by means of growth rate, conidia measurement, and immunogenic reaction. Can. J. Bot. 53: 2506-2525, 1975.