Pochonia chlamydosporia var. chlamydosporia (Goddard) Zare et Gams (ATCC® MYA-4875)

Alternate State: Metacordyceps chlamydosporia (Evans) Sung et al.  /  Strain Designations: 123  /  Product Format: frozen

Permits and Restrictions

View Permits

Strain Designations 123
Alternate State Metacordyceps chlamydosporia (Evans) Sung et al.
Application
Biocontrol agent of plant parasitic nematodes.
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Genome Sequenced Strain

Yes

Comments
Egg-parasitic nematophagous fungus.
Genome sequencing strain (Donnelly Sequencing Centre, University of Toronto, Canada).
Morphology On PDA medium at 25°C after 7 days, mycelium white to pale yellow, very dense, raised, velvety. Produces a clear exudates after 7 days. Reverse mustard yellow to bright yellow center with pale yellow margin. Hyphae guttulate. Clamp connections not observed.
Medium ATCC® Medium 307: Cornmeal agar
ATCC® Medium 336: Potato dextrose agar (PDA)
Growth Conditions
Temperature: 20°C to 25°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence.

TAACAAGGTCTCCGTTGGTGAACCAGCGGAGGGATCATTACCGAGTTTTCAACTCCCAAACCCCATGTGAACTTATACCATTTACAACCGTTGCTTCGGCGGGTTCTCGCCCCGGGCTTTACACCCCGGAACCAGGCGGCCCGCCGGGGGACCCAAACTCTAGATTTTTATTTTAGCATGTCTGAGTGGAATCATTACAAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCCCCAGCGGTTTGGTGTTGGGGACCGGCGAGTACAGAGGCTTTGGGGACTTGTCCCCCTTCCCTCGGCGCCGCCCCCGAAATGAATTGGCGGTCTCGTCGCGGCCTCCTCTGCGTAGTAGCACAACCTCGCATCAGGAGCGCGGCGCGGCCACTGCCGTAAAACGCCCAACTTTTTTTAAGAGTTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGG


D1D2 region of the 28S ribosomal RNA gene:

TTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCCTAGGGCCCGAGTTGTAATTTGCAGAGGATGCTTTTGGCGAGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCATAGAGGGTGAGAGCCCCGTCTGGTTGGATGCCGAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTATATGTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGTACGTGAAATTGTTGAAAGGGAAGCACTTATGACCAGACTTGGACCCGGTGAATCATCCAGCGTTCTCGCTGGTGCACTTTGCCGGGCTCAGGCCAGCATCAGTTTGCCTCGGGGGATAAAGGCTTTGGGAATGTGGCTCCCTCGGGAGTGTTATAGCCCATTGCACAATACCCTGGGGCGGACTGAGGTTCGCGCATCTGCAAGGATGCTGG

Morphology On PDA medium at 25°C after 7 days, mycelium white to pale yellow, very dense, raised, velvety. Produces a clear exudates after 7 days. Reverse mustard yellow to bright yellow center with pale yellow margin. Hyphae guttulate. Clamp connections not observed.
Name of Depositor LV Lopez-Llorca
Special Collection ATCC
Chain of Custody
ATCC <-- LV Lopez-Llorca
Isolation
Eggs from phytopathogenic nematode Heterodera avenae, Sevilla, Spain.
References

Lopez-Llorca LV, et al. Expression of serine proteases in egg-parasitic nematophagous fungi during barley root colonization. Fung. Genet. Biol. 47: 342-351, 2010.

Macia-Vicente JG, Jansson HB, and Lopez-Llorca LV. Assessing fungal root colonization for plant improvement. Plant Signal. Behav. 4(5): 445-447, 2009.

Palma-Guerrero J, et al. Chitosan increases conidiation in fungal pathogens of invertebrates. Appl. Microbiol. Biotechnol. 87: 2237-2245, 2010.

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation