Pochonia chlamydosporia var. chlamydosporia (Goddard) Zare et Gams (ATCC® MYA-4875)

Alternate State: Metacordyceps chlamydosporia (Evans) Sung et al.  /  Strain Designations: 123  /  Product Format: frozen

Permits and Restrictions

View Permits

Strain Designations 123
Alternate State Metacordyceps chlamydosporia (Evans) Sung et al.
Application
Biocontrol agent of plant parasitic nematodes.
Biosafety Level 1
Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Type Strain no
Preceptrol® no
Genome Sequenced Strain

Yes

Comments
Egg-parasitic nematophagous fungus.
Genome sequencing strain (Donnelly Sequencing Centre, University of Toronto, Canada).
Morphology On PDA medium at 25°C after 7 days, mycelium white to pale yellow, very dense, raised, velvety. Produces a clear exudates after 7 days. Reverse mustard yellow to bright yellow center with pale yellow margin. Hyphae guttulate. Clamp connections not observed.
Medium Medium 307: Cornmeal agar
Medium 336: Potato dextrose agar (PDA)
Growth Conditions
Temperature: 20°C to 25°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence.

TAACAAGGTCTCCGTTGGTGAACCAGCGGAGGGATCATTACCGAGTTTTCAACTCCCAAACCCCATGTGAACTTATACCATTTACAACCGTTGCTTCGGCGGGTTCTCGCCCCGGGCTTTACACCCCGGAACCAGGCGGCCCGCCGGGGGACCCAAACTCTAGATTTTTATTTTAGCATGTCTGAGTGGAATCATTACAAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCCCCAGCGGTTTGGTGTTGGGGACCGGCGAGTACAGAGGCTTTGGGGACTTGTCCCCCTTCCCTCGGCGCCGCCCCCGAAATGAATTGGCGGTCTCGTCGCGGCCTCCTCTGCGTAGTAGCACAACCTCGCATCAGGAGCGCGGCGCGGCCACTGCCGTAAAACGCCCAACTTTTTTTAAGAGTTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGG


D1D2 region of the 28S ribosomal RNA gene:

TTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCCTAGGGCCCGAGTTGTAATTTGCAGAGGATGCTTTTGGCGAGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCATAGAGGGTGAGAGCCCCGTCTGGTTGGATGCCGAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTATATGTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGTACGTGAAATTGTTGAAAGGGAAGCACTTATGACCAGACTTGGACCCGGTGAATCATCCAGCGTTCTCGCTGGTGCACTTTGCCGGGCTCAGGCCAGCATCAGTTTGCCTCGGGGGATAAAGGCTTTGGGAATGTGGCTCCCTCGGGAGTGTTATAGCCCATTGCACAATACCCTGGGGCGGACTGAGGTTCGCGCATCTGCAAGGATGCTGG

Morphology On PDA medium at 25°C after 7 days, mycelium white to pale yellow, very dense, raised, velvety. Produces a clear exudates after 7 days. Reverse mustard yellow to bright yellow center with pale yellow margin. Hyphae guttulate. Clamp connections not observed.
Name of Depositor LV Lopez-Llorca
Special Collection ATCC
Chain of Custody
ATCC <-- LV Lopez-Llorca
Isolation
Eggs from phytopathogenic nematode Heterodera avenae, Sevilla, Spain.
References

Lopez-Llorca LV, et al. Expression of serine proteases in egg-parasitic nematophagous fungi during barley root colonization. Fung. Genet. Biol. 47: 342-351, 2010.

Macia-Vicente JG, Jansson HB, and Lopez-Llorca LV. Assessing fungal root colonization for plant improvement. Plant Signal. Behav. 4(5): 445-447, 2009.

Palma-Guerrero J, et al. Chitosan increases conidiation in fungal pathogens of invertebrates. Appl. Microbiol. Biotechnol. 87: 2237-2245, 2010.

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation