Dactylella oviparasitica Stirling et Mankau, anamorph (ATCC® 38908)

Product Format: frozen

Permits and Restrictions

View Permits

Application
biological control of nematodes
Biosafety Level 1
Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Comments
characterization
Morphology On Emerson YpSs medium at 25°C after 20 days, mycelium white, velutinous to cottony, dense, raised. Reverse tan. Hyphae hyaline, guttulate.
Medium Medium 350: Emerson YpSs agar
Medium 307: Cornmeal agar
Growth Conditions
Temperature: 24°C to 26°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

AAGGATCATTACAGTAGTAATGCACGGAGCACGCCGGCCCTCAACCACGAACCCCCTCCCCCGGGGGATTGGAACCGAGGCGGTGCTGCCACCGCACGTCCGGATGCTTAGCCGAGCCACCAGGCTTCGGCGGCGGTCCTGAGACGTTTAACCCTCTGTGAAAACCCTCAGTTGCTTCGGCAGCGCGTCCCGCCCTCGCTGGCGGGACGGTCAGCCTGCCGGCGGCACCCAACCAAAACCCACGCGTGTAATTTAGCAAAATTTTACGTCTGAGCGCGAAGTCGAATTGACTATAAAACTTTCAACAACGGATCTCTTGGTTCCCGCATCGATGAAGAACGCAGCGAAACGCGATAGTTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCTTTTGGTATTCCGAGAGGCACGTCTGTTCGAGCGTCAGTAAAACCCTTCCGGACCGGCGGTTTTGTTACCGCCCGGCCTGGGACCCTGGCGTGGGGAAGCGAAACCCTCTCACGGGTTTTTCCCCCGCTTAAACGCGGAGAAAGCTAGCGGGCACAGGCCTCACGTATTGCGACAACTCGTAAAATCTTTATAGGTTGTTACCGCTAACAGTGGACCTTGCCCCGCCTCCTGAAACCTACGGGAACTCCGTTCCCCTGACTCTTGACCTCGGATCAGATGAGGATACCCGCTGAACTTAA


D1D2 region of the 28S ribosomal RNA gene

ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTCAGTAGCGGCGAGTGAAGCGGCAAAAGCTCAGATTTGAAATCCGGTGCGCTCAGCGCCCCCGAGTTGTAATCTGGAGAGGATGCTTCGGCGAGAACCCCGGCCCAAGTCCCTTGGAACAGGGCGTCTTAGAGGGTGAGAACCCCGTACCCGGCAGGCGGTTTTAGCCATGTGTAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAACTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCCATCAGAATCGGTGCCGGTCGATCAACGTTCCTTCTGGTTCGTGCACTCGTCCGGTTTCCGTGCCAGCATCGGTTGGCGCGGCGGGACAAAGGCCGCGGGAAAGTGGCTCCCCTCGGGGAGTGTTATAGCCCGCGGTGCAATACCGCCTGCGCCGACCGAGGACCGCGCTTCGTGCAAGGATGCTGGCCTAATGGTTGTAAGCGA

Morphology On Emerson YpSs medium at 25°C after 20 days, mycelium white, velutinous to cottony, dense, raised. Reverse tan. Hyphae hyaline, guttulate.
Name of Depositor GR Stirling
Isolation
Meloidogyne sp. egg masses
References

Stirling GR, Mankau R. Dactylella oviparasitica, a new fungal parasite of Meloidogyne eggs. Mycologia 70: 774-783, 1978.

Stirling GR, Mankau R. Parasitism of meloidogyne eggs by a new fungal parasite. J. Nematol. 10: 236-240, 1978.

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation