Alternaria eichhorniae Nag Raj et Ponnappa, anamorph (ATCC® 22255)

Strain Designations: 198 [ATCC 46777, ATCC 201659, CBS 489.92, CIBC 97, IMI 121518]  /  Product Format: frozen

Permits and Restrictions

View Permits

Strain Designations 198 [ATCC 46777, ATCC 201659, CBS 489.92, CIBC 97, IMI 121518]
Application
Produces 4-deoxybostrycin
Produces bostrycin
Biological control of water hyacinths, Eichhornia crassipes
Biosafety Level 1
Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain yes
Preceptrol® no
Morphology After 10 days at 25°C colonies are velvety or felty, effuse at the edges, red, generally with sparse olive-green sporulating patches; on nutrient agar the fungus produces an intense red pigment. Conidia in culture tend to be less septate and are pale chestnut-brown, and scars are clearly visible.
Medium ATCC® Medium 200: YM agar or YM broth
ATCC® Medium 323: Malt agar medium
ATCC® Medium 336: Potato dextrose agar (PDA)
Growth Conditions
Temperature: 24°C to 26°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

TCTCCGTAGGTGAACCTGCGGAGGGATCATTACACAAATATGAAGGCGGGCTGGAACCTCTCGGGGTTACAGCCTTGCTGAATTATTCACCCTTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTTGCCCACCACAAGGACAAACATAAACCTTTTGTAATTGCAATCAGCGTCAGTAACAAATTAATAATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTCTTGTCTCTAGCTTTGCTGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCACTCTCTATCAGCAAAGGTCTAGCATCCATTAAGCCTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAG


D1D2 region of the 28S ribosomal RNA gene

CATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGCTTTTGCCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGGC

Morphology After 10 days at 25°C colonies are velvety or felty, effuse at the edges, red, generally with sparse olive-green sporulating patches; on nutrient agar the fungus produces an intense red pigment. Conidia in culture tend to be less septate and are pale chestnut-brown, and scars are clearly visible.
Name of Depositor R Charudattan
Isolation
Water hyacinth, Eichhornia crassipes, India
Cross References

Nucleotide (GenBank) : KC146356 ITS including 5.8S rRNA gene

Nucleotide (GenBank) : KC146371 D1/D2 region of 28S rRNA gene

References

Charudattan R, Rao KV. Bostrycin and 4-deoxybostrycin: two nonspecific phytotoxins produced by Alternaria eichhorniae. Appl. Environ. Microbiol. 43: 846-849, 1982. PubMed: 6805431

Nag Raj TR, Ponnappa KM. Blight of water-hyacinth caused by Alternaria eichhorniae sp.nov.. Trans. Br. Mycol. Soc. 55: 123-130, 1970.

Stevens KL, et al. The antibiotic bostrycin from Alternaria eichhorniae. Phytochemistry 18: 1579-1580, 1979.

Charudattan R. Pathogenicity of fungi and bacteria from India to Hydrilla and waterhyacinth. Hyacinth Control J. 11: 44-48, 1973.

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
  • USDA APHIS PPQ Permit 526, plant pathogens permit must be obtained and a copy of the permit must be sent to ATCC in advance of shipment. Isolation information for this item is required by USDA. Please check our website or contact Technical Service for assistance. Domestic isolates are easier to obtain than foreign isolates.
Basic Documentation