Trichoderma atroviride Karsten sensu Bissett, anamorph (ATCC® 20476)

Alternate State: Hypocrea atroviridis Dodd et al., teleomorph  /  Strain Designations: T  /  Product Format: freeze-dried

Permits and Restrictions

View Permits

Deposited As Trichoderma viride Persoon : Fries, anamorph
Strain Designations T
Alternate State Hypocrea atroviridis Dodd et al., teleomorph
Application
biological control of wood decay fungi
Biosafety Level 1
Product Format freeze-dried
Type Strain no
Preceptrol® no
Morphology

On malt extract medium after 3-4 days colonies with rapid growth, cream-colored at first, soon becoming green due to abundant sporulation, starting at the edge of the colony.  Conidiophores hyaline, loosely branched at right angles.  Phialides flask-shaped, with very short, hardly visible collarettes.  Conidia spherical to ellipsoidal, pale green,

  

Medium Medium 325: Malt extract agar (Blakeslee's formula)
Growth Conditions
Temperature: 24.0°C
Sequenced Data
GenBank accession number: JQ745258

18S ribosomal RNA gene, partial sequence; internal   transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence.

TCCGTTGGTGAACCAGCGGAGGGATCATTACCGAGTTTACAACTCCCAAACCCAATGTGAACCATACCAAACTGTTGCCTCGGCGGGGTCACGCCCCGGGTGCGTCGCAGCCCCGGAACCAGGCGCCCGCCGGAGGGACCAACCAAACTCTTTTCTGTAGTCCCCTCGCGGACGTTATTTCTTACAGCTCTGAGCAAAAATTCAAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTCCGAGCGTCATTTCAACCCTCGAACCCCTCCGGGGGGTCGGCGTTGGGGACCTCGGGAGCCCCTAAGACGGGATCCCGGCCCCGAAATACAGTGGCGGTCTCGCCGCAGCCTCTCCTGCGCAGTAGTTTGCACAACTCGCACCGGGAGCGCGGCGCGTCCACGTCCGTAAAACACCCAACTTCTGAAATGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAAG

GenBank accession number: JQ745264

Large subunit ribosomal RNA gene, partial sequence

CATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCCTAGGGTCCGAGTTGTAATTTGTAGAGGATGCTTTTGGTGAGGTGCCGCCCGAGTTCCCTGGAACGGGACGCCGCAGAGGGTGAGAGCCCCGTCTGGCTGGCCACCGAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTATATGTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAAAAGAGGGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGTGACCAGACTTGGGCGCGGCGGATCATCCGGGGTTCTCCCCGGTGCACTTCGCCGTGTTCAGGCCAGCATCAGTTCGGCGCGGGGGAAAAAGGCTTCGGGAACGTGGCTCCTCCGGGAGTGTTATAGCCCGTTGCATAATACCCTGCGCTGGACTGAGGACCGCGCATCTGCAAGGATGCTGGCGTAATGGTCACCAGCGAC

Morphology

On malt extract medium after 3-4 days colonies with rapid growth, cream-colored at first, soon becoming green due to abundant sporulation, starting at the edge of the colony.  Conidiophores hyaline, loosely branched at right angles.  Phialides flask-shaped, with very short, hardly visible collarettes.  Conidia spherical to ellipsoidal, pale green,

  

Name of Depositor BINAB
Isolation
plum tree, Sweden
References

Highley TL, Ricard J. Antagonism of Trichoderma spp. and Gliocladium virens against wood decay fungi. Mater. Org. 23: 157-169, 1988.

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation