Aspergillus fumigatus Fresenius, anamorph (ATCC® MYA-1163)

Strain Designations: NIH 4215  /  Product Format: frozen

Permits and Restrictions

View Permits

Strain Designations NIH 4215
Application
control with interleukin-12 in rabbits
control with BMS 181184 in rabbits
control with LY303366 in rabbits
control with liposomal nystatin in rabbits
Emerging infectious disease research
Biomedical Research and Development Material
Opportunistic pathogen research
Respiratory research
Biosafety Level 2
Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Comments
control with interleukin-12 in rabbits
control with BMS 181184 in rabbits
control with LY303366 in rabbits
control with liposomal nystatin in rabbits
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

TCCGTAGGTGAACCTGCGGAAGGATCATTACCGAGTGAGGGCCCTCTGGGTCCAACCTCCCACCCGTGTCTATCGTACCTTGTTGCTTCGGCGGGCCCGCCGTTTCGACGGCCGCCGGGGAGGCCTTGCGCCCCCGGGCCCGCGCCCGCCGAAGACCCCAACATGAACGCTGTTCTGAAAGTATGCAGTCTGAGTTGATTATCGTAATCAGTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCACGGCTTGTGTGTTGGGCCCCCGTCCCCCTCTCCCGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGGTCCTCGAGCGTATGGGGCTTTGTCACCTGCTCTGTAGGCCCGGCCGGCGCCAGCCGACACCCAACTTTATTTTTCTAAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAG

Name of Depositor TJ Walsh
Special Collection NCRR Contract
Isolation
19-year-old man with acute lymphoblastic leukemia and neutropenia, Bethesda, MD
Cross References

Nucleotide (GenBank) : KC689330 ITS including 5.8S rRNA gene

References

Roilides E, et al. Interleukin-12 enhances antifungal activity of human mononuclear phagocytes against Aspergillus fumigatus: implications for a gamma interferon-independent pathway. Infect. Immun. 67: 3047-3050, 1999. PubMed: 10338518

Gonzalez CE, et al. Antifungal activity of the pradimicin derivative BMS 181184 in the treatment of experimental pulmonary aspergillosis in persistently neutropenic rabbits. Antimicrob. Agents Chemother. 42: 2399-2404, 1998. PubMed: 9736570

Petraitis V, et al. Antifungal efficacy, safety, and single-dose pharmacokinetics of LY303366, a novel echinocandin B, in experimental pulmonary aspergillosis in persistently neutropenic rabbits. Antimicrob. Agents Chemother. 42: 2898-2905, 1998. PubMed: 9797223

Groll AH, et al. Liposomal nystatin against experimental pulmonary aspergillosis in persistently neutropenic rabbits: efficacy, safety and non-compartmental pharmacokinetics. J. Antimicrob. Chemother. 43: 95-103, 1999. PubMed: 10381106

Thomas J Walsh, personal communication

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation