Aspergillus fumigatus Fresenius, anamorph (ATCC® 90240)

Strain Designations: 10/AF/86/10/1  /  Product Format: freeze-dried

Permits and Restrictions

View Permits

Strain Designations 10/AF/86/10/1
Application
Control with cilofungin
Biomedical Research and Development Material
Emerging infectious disease research
Opportunistic pathogen research
Respiratory research
Biosafety Level 2

Biosafety  classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format freeze-dried
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Comments
Epidemiology, isolate 10
Control with cilofungin
Preservation
Hydrocortisone-enhanced growth
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

TCCGTAGGTGAACCTGCGGAAGGATCATTACCGAGTGAGGGCCCTCTGGGTCCAACCTCCCACCCGTGTCTATCGTACCTTGTTGCTTCGGCGGGCCCGCCGTTTCGACGGCCGCCGGGGAGGCCTTGCGCCCCCGGGCCCGCGCCCGCCGAAGACCCCAACATGAACGCTGTTCTGAAAGTATGCAGTCTGAGTTGATTATCGTAATCAGTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCACGGCTTGTGTGTTGGGCCCCCGTCCCCCTCTCCCGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGGTCCTCGAGCGTATGGGGCTTTGTCACCTGCTCTGTAGGCCCGGCCGGCGCCAGCCGACACCCAACTTTATTTTTCTAAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAG

Name of Depositor DW Denning
Chain of Custody
ATCC <-- DW Denning <-- UCLA Hosp.
Isolation
Lung aspirate of patient with multiple sclerosis, Los Angeles, CA
Cross References

Nucleotide (GenBank) : KC689325 ITS including 5.8S rRNA gene

References

Ng TT, et al. Hydrocortisone-enhanced growth of Aspergillus spp.: implications for pathogenesis. Microbiology 140: 2475-2479, 1994. PubMed: 7952197

Denning DW, et al. Quantitative preservation of viability of Aspergillus fumigatus. J. Med. Vet. Mycol. 30: 485-488, 1992. PubMed: 1287169

Denning DW, Stevens DA. Efficacy of cilofungin alone and in combination with amphotericin B in a murine model of disseminated aspergillosis. Antimicrob. Agents Chemother. 35: 1329-1333, 1991. PubMed: 1929289

Denning DW, et al. Restriction endonuclease analysis of total cellular DNA of Aspergillus fumigatus isolates of geographically and epidemiologically diverse origin. J. Infect. Dis. 162: 1151-1158, 1990. PubMed: 1977804

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation