Aspergillus fumigatus Fresenius, anamorph (ATCC® 90240)

Strain Designations: 10/AF/86/10/1  /  Product Format: freeze-dried

Permits and Restrictions

View Permits

Strain Designations 10/AF/86/10/1
Application
Control with cilofungin
Biomedical Research and Development Material
Emerging infectious disease research
Opportunistic pathogen research
Respiratory research
Biosafety Level 2
Product Format freeze-dried
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Type Strain no
Preceptrol® no
Comments
Epidemiology, isolate 10
Control with cilofungin
Preservation
Hydrocortisone-enhanced growth
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

TCCGTAGGTGAACCTGCGGAAGGATCATTACCGAGTGAGGGCCCTCTGGGTCCAACCTCCCACCCGTGTCTATCGTACCTTGTTGCTTCGGCGGGCCCGCCGTTTCGACGGCCGCCGGGGAGGCCTTGCGCCCCCGGGCCCGCGCCCGCCGAAGACCCCAACATGAACGCTGTTCTGAAAGTATGCAGTCTGAGTTGATTATCGTAATCAGTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCACGGCTTGTGTGTTGGGCCCCCGTCCCCCTCTCCCGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGGTCCTCGAGCGTATGGGGCTTTGTCACCTGCTCTGTAGGCCCGGCCGGCGCCAGCCGACACCCAACTTTATTTTTCTAAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAG

Name of Depositor DW Denning
Chain of Custody
ATCC <-- DW Denning <-- UCLA Hosp.
Isolation
Lung aspirate of patient with multiple sclerosis, Los Angeles, CA
Cross References

Nucleotide (GenBank) : KC689325 ITS including 5.8S rRNA gene

References

Ng TT, et al. Hydrocortisone-enhanced growth of Aspergillus spp.: implications for pathogenesis. Microbiology 140: 2475-2479, 1994. PubMed: 7952197

Denning DW, et al. Quantitative preservation of viability of Aspergillus fumigatus. J. Med. Vet. Mycol. 30: 485-488, 1992. PubMed: 1287169

Denning DW, Stevens DA. Efficacy of cilofungin alone and in combination with amphotericin B in a murine model of disseminated aspergillosis. Antimicrob. Agents Chemother. 35: 1329-1333, 1991. PubMed: 1929289

Denning DW, et al. Restriction endonuclease analysis of total cellular DNA of Aspergillus fumigatus isolates of geographically and epidemiologically diverse origin. J. Infect. Dis. 162: 1151-1158, 1990. PubMed: 1977804

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation