Meyerozyma guilliermondii (Wickerham) Kurtzman et M. Suzuki (ATCC® 6260)

Strain Designations: [ATCC 7350, CBS 566, DBVPG 6140, IFO 10279, IGC 2730, JCM 1539, NRRL Y-324]  /  Product Format: freeze-dried

Deposited As Monilia guilliermondii (Castellani) Castellani et Chalmers
Strain Designations [ATCC 7350, CBS 566, DBVPG 6140, IFO 10279, IGC 2730, JCM 1539, NRRL Y-324]
Application
Produces riboflavin vitamin B2
Quality control strain
Quality control strain for API products
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format freeze-dried
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain yes (type strain of Candida guilliermondii)
Preceptrol® yes
Genome Sequenced Strain

Yes

Comments
Genome sequencing strain (Broad Institute, USA).
Morphology On YM medium at 25°C after 4 days, colonies creamy white to dingy white, butyrous, dull, smooth, margin entire. Cells hyaline, ellipsoidal, smooth, 4-5.5 X 2.5-4 µm. Pseudohyphae not observed.
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

GGTTTCCGTAGGTGAACCTGCGGAAGGATCATTACAGTATTCTTTTGCCAGCGCTTAACTGCGCGGCGAAAAACCTTACACACAGTGTCTTTTTGATACAGAACTCTTGCTTTGGTTTGGCCTAGAGATAGGTTGGGCCAGAGGTTTAACAAAACACAATTTAATTATTTTTACAGTTAGTCAAATTTTGAATTAATCTTCAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATATGAATTGCAGATTTTCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTCTGGTATTCCAGAGGGCATGCCTGTTTGAGCGTCATTTCTCTCTCAAACCCCCGGGTTTGGTATTGAGTGATACTCTTAGTCGGACTAGGCGTTTGCTTGAAAAGTATTGGCATGGGTAGTACTGGATAGTGCTGTCGACCTCTCAATGTATTAGGTTTATCCAACTCGTTGAATGGTGTGGCGGGATATTTCTGGTATTGTTGGCCCGGCCTTACAACAACCAAACAAGCTTGACCTCAAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAA


D1D2 region of the 26S ribosomal RNA gene

ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTTAGTAGCGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCGCCTTCGGTGTCCGAGTTGTAATTTGAAGATTGTAACCTTGGGGTTGGCTCTTGTCTATGTTTCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTGCGATGAGATGCCCAATTCTATGTAAGGTGCTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGTTTGAGATCAGACTCGATATTTTGTGAGCCTTGCCTTCGTGGCGGGGTGACCCGCAGCTTATCGGGCCAGCATCGGTTTGGGCGGTAGGATAATGGCGTAGGAATGTGACTTTACTTCGGTGAAGTGTTATAGCCTGCGTTGATGCTGCCTGCCTAGACCGAGGACTGCGATTTTATCAAGGATGCTGGCATAATGATCCCAAACCGC

Morphology On YM medium at 25°C after 4 days, colonies creamy white to dingy white, butyrous, dull, smooth, margin entire. Cells hyaline, ellipsoidal, smooth, 4-5.5 X 2.5-4 µm. Pseudohyphae not observed.
Name of Depositor A Castellani
Chain of Custody ATCC <-- A Castellani
Isolation
Sputum from patient with bronchomycosis
Cross References

Nucleotide (GenBank) : M60304 C.guilliermondii small subunit ribosomal RNA.

Nucleotide (GenBank) : AF218967 Pichia guilliermondii strain ATCC 6260T 5.8S ribosomal RNA gene

Complete Genome (GenBank) : AAFM00000000 Meyerozyma guilliermondii ATCC 6260, whole genome shotgun sequencing project

References

API 20C AUX. bioMerieux.

Butler G, et al. Evolution of pathogenicity and sexual reproduction in eight Candida genomes. Nature 459: 657-662, 2009. PubMed: 19465905

Foureau E, et al. A TRP5/5-fluoroanthranilic acid counter-selection system for gene disruption in Candida guilliermondii. Curr. Genet. 58: 245-254, 2012. PubMed: 22618436

Garcia-Effron G, et al. Assessment of two new molecular methods for identification of Candida parapsilosis sensu lato species. J. Clin. Microbiol. 49: 3257-3261, 2011. PubMed: 21795509

Desnos-Ollivier M, et al. Debaryomyces hansenii (Candida famata), a rare human fungal pathogen often misidentified as Pichia guilliermondii (Candida guilliermondii). J. Clin. Microbiol. 46: 3237-3242, 2008. PubMed: 18701668

Daniel HM, Meyer W. Evaluation of ribosomal RNA and actin gene sequences for the identification of ascomycetous yeasts. Int. J. Food Microbiol. 86: 61-78, 2003. PubMed: 12892922

Sugita T, Nakase T. Non-universal usage of the leucine CUG codon and the molecular phylogeny of the genus Candida. Syst Appl Microbiol 22: 79-86, 1999. PubMed: 10188281

Suzuki M, Nakase T. Cellular neutral sugar compositions and ubiquinone systems of the genus Candida. Microbiol. Cult. Collect. 14: 49-62, 1998.

Thanos M, et al. Rapid identification of Candida species by DNA fingerprinting with PCR. J Clin Microbiol 34: 615-621, 1996. PubMed: 8904425

Tanner FW Jr., et al. Riboflavin production by Candida species. Science 101: 180-181, 1945.

Castellani AJ. Observations on the fungi found in tropical bronchomycosis. Lancet 1: 13-15, 1912.

type strain of Candida guilliermondii