Geotrichum sp. (ATCC® 34614)

Product Format: freeze-dried

Permits and Restrictions

View Permits

Deposited As Geotrichum candidum Link : Persoon, anamorph
Application
Degrades sauerkraut brine
Produces acetoin dehydrogenase diacetyl reductase
Produces lactate dehydrogenase
Produces lipase
Produces polygalacturonase endopolygalacturonase, pectinase
Quality control strain
Produces lipases I and II
Produces type A lipase
Produces extracellular lipase from sauerkraut brine
Produces acetoin dehydrogenase from sauerkraut brine
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format freeze-dried
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® yes
Comments
Crystal structure of lipase
cDNA clone of lipase genes
Morphology On YM medium at 25°C after 3 days, colonies white to dingy white, finely hairy (able to see the branching hyphae in the texture), dense, raised. Hyphae hyaline, guttulate. Arthroconidia rectangular to cubic, hyaline, smooth, 6-7.5 X 3-3.75 µm. Yeast cells subglobose to oval, hyaline, smooth, larger cells 9-12 X 4.5-8.25 µm, smaller cells 5.25-6 X 4.5-5.25 µm.
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

TCAAAACAAAAATAATCAAAACTTTTAACAATGGATCTCTTGGTTCTCGTATCGATGAAGAACGCAGCGAAACGCGATATTTCTTGTGAATTGCAGAAGTGAATCATCAGTTTTTGAACGCACATTGCACTTTGGGGTATCCCCCAAAGTATACTTGTTTGAGCGTTGTTTCTCTCTTGGAATTGCATTGCTTTTCTAAAATTTCGAATCAAATTCGTTTGAAAAACAACACTATTCAACCTCAGATCAAGTAGGATTACCCGCTGAACTTAA


D1D2 region of the 28S ribosomal RNA gene

ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCGGCCACCAGGTCGAGTTGTAATTTGTAGATTGTATCTTGAGAGCGGATTAAAGTCTGTTGGAACACAGCGCCTTAGAGGGTGACAGCCCCGTAAAATCTATTCTCATTGTAAGATACTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGAGGTAAATTCCTTCTAAAGCTAAATATTGACGAGAGACCGATAGCGAACAAGTACTGTGAAGGAAAGATGAAAAGCACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTAAAAGGGAAGGGTATTGAATCAGACTTGGTGCTGTTGTTCAACTGTGTTTCGGCAYAGTGTACTCAGCAGTACTAGGCCAAGGTGGGGTGTTTGGGAGTGAAAAAGAAGTWGGAACGTAACTCTTCGGAGTGTTATAGCCTACTTTCATAGCTCCTCAGGCGCCTCAGGACTGCGCTTCGGCAAGGACCTTGGCATAATGATTCTATACCG

Morphology On YM medium at 25°C after 3 days, colonies white to dingy white, finely hairy (able to see the branching hyphae in the texture), dense, raised. Hyphae hyaline, guttulate. Arthroconidia rectangular to cubic, hyaline, smooth, 6-7.5 X 3-3.75 µm. Yeast cells subglobose to oval, hyaline, smooth, larger cells 9-12 X 4.5-8.25 µm, smaller cells 5.25-6 X 4.5-5.25 µm.
Name of Depositor M Iwai
Isolation
Clotted carrot, Japan
Cross References

Nucleotide (GenBank) : E02497 cDNA encoding Geotrichum candidum lipase.

Nucleotide (GenBank) : U02622 Geotrichum candidum ATCC 34614 lipase gene, partial cds.

Nucleotide (GenBank) : U26858 Galactomyces geotrichum isolate g56 28S rRNA gene, partial

Nucleotide (GenBank) : U02541 Geotrichum candidum ATCC 34614 lipase II gene, partial cds.

References

. . Food Chem. 45: 15-17, 1992.

Hang YD, Woodams EE. Production and characterization of polygalacturonase from Geotrichum candidum. World J. Microbiol. Biotechnol. 8: 480-482, 1992.

Jacobsen T, Poulsen OM. Comparison of lipases from different strains of the fungus Geotrichum candidum. Biochim. Biophys. Acta 1257: 96-102, 1995. PubMed: 7619863

Shimada Y, et al. cDNA molecular cloning of Geotrichum candidum lipase. J. Biochem. 106: 383-388, 1989. PubMed: 2481674

Nagao T, et al. Cloning and sequencing of two chromosomal lipase genes from Geotrichum candidum. J. Biochem. 113: 776-780, 1993. PubMed: 8370674

Schrag JD, et al. Multiple crystal forms of lipases from Geotrichum candidum. J. Mol. Biol. 220: 541-543, 1991. PubMed: 1870119

. . Bioresour. Technol. 43: 181-183, 1993.

Hata Y, et al. Low resolution crystal structure of lipase from Geotrichum candidum (ATCC34614). J. Biochem. 86: 1821-1827, 1979. PubMed: 575138

Sugihara A, et al. Separation and characterization of two molecular forms of Geotrichum candidum lipase. J. Biochem. 107: 426-430, 1990. PubMed: 2341377

Shimada Y, et al. cDNA cloning and characterization of Geotrichum candidum lipase II. J. Biochem. 107: 703-707, 1990. PubMed: 2398037

Catoni E, et al. Overexpression of lipase A and B of Geotrichum candidum in Pichia pastoris: high-level production and some properties of functional expressed lipase B. Biotechnol. Tech. 11: 689-695, 1997.

Iwai M, et al. Lipid requirement for the lipase production by Geotrichum candidum Link. Agric. Biol. Chem. 37: 929-931, 1973.

Iwai M, et al. Synthesis of terpene alcohol esters by lipase. Agric. Biol. Chem. 44: 2731-2732, 1980.

Hang YD, Woodams EE. Lipase production by Geotrichum candidum from sauerkraut brine. World J. Microbiol. Biotechnol. 6: 418-421, 1990.

FF MicroPlate. Biolog.

YT MicroPlate QC Set. Biolog.

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation