Septobasidium burtii Lloyd (ATCC® MYA-4635)

Strain Designations: ECS 7 [MIN 878588]  /  Product Format: frozen

Permits and Restrictions

View Permits

Strain Designations ECS 7 [MIN 878588]
Biosafety Level 1
Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Comments
Reference strain for AFTOL (Assembling the Fungal Tree of Life) project.
Sequenced Data
ITS DNA sequence of MYA-4635

AGGATCATTAGTGAATTTGTTGGATTTCTAATCCACACTCTCTCACTTTCTAACCCTGTGAACTTATTATAAAATGGCATTTGAATGTTAACGCGTTCGTTTGTTGTTTTTTATATTATAAACTTAGTAAAGTTGAAGAATGTATTTTTTTATAACAAATAAAAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGAATTGCAGAATTCAGTGAACCATCGAATCTTTGAACGCACCTTGCACTCTTTGGTATTCCGAAGAGTATGCCTGTTTGAGTGTTATGAAATCTCTCAACCTATCATTTTTCATTAGAACTTTGATTAGGATTGGATTCTGAACGTTGCTGACTAGTTTACTAGTGGAGCTCGTTTGAAATAGAATAGCAAATGTCTGATCTTTAATCGGTTTGACTTGGCGTAATAAGTAACATTTCGCTAAGGATTATCCTCTGGGTAACCGAATTTTGTATTAATGACTTGCTTCTAAATCTTAATTTTCTAATTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAAT

Name of Depositor MC Aime
Special Collection ATCC
Chain of Custody
ATCC <-- MC Aime
Cross References

Nucleotide (GenBank) : GU291279 ITS including 5.8S rRNA gene

References

Hibbett DS, et al. A higher level phylogenetic classification of the Fungi. Mycol. Res. 111: 509-547, 2007.

Aime MC, et al. An overview of the higher level classification of Pucciniomycotina based on combined analyses of nuclear large and small subunit rDNA sequences. Mycologia 98: 896-905, 2006.

McLaughlin DJ, et al. Mitosis in the yeast phase of the basidiomycetes Bensingtonia yuccicola and Stilbum vulgare and its phylogenetic implications. Am. J. Bot. 91: 808-815, 2004.

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation