Candida gatunensis Suh et al. (ATCC® MYA-4355)

Strain Designations: BG 05-8-8-005A-2-2 [CBS 10379, NRRL Y-48064]  /  Product Format: frozen

Permits and Restrictions

View Permits

Strain Designations BG 05-8-8-005A-2-2 [CBS 10379, NRRL Y-48064]
Biosafety Level 1
Product Format frozen
Type Strain yes
Preceptrol® no
Comments
Insect associated yeast isolated from digestive tract of tropical mushroom feeding beetle.
Growth Conditions
Temperature: 20.0-25.0°C
Sequenced Data
>LSU rDNA of MYA-4355

ATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTCCGTAAAGGCGAGTTGTAATTTGAAGAAGCGACTTTGGACTGGTTCCTTGTCTATGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTGCGATGAGGGCCACCAGTGCATGTAAAGTGCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGCACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGCTTGAGATCAGACTTGGTGACTCGTCACTGGGCCAGCATCGGTTTGGGTGGTAGGACAATACCGTAGGAACGTAGCTCATTTTTTGAGTGTTATAGGCTGCGGGGATACTGCCTATCCAGACCGAGGACTGCGGCAACTAGGATGCTGGCATAATGATCTTAAGCCGC

//

>ITS of MYA-4355

TTTCCGTAGGTGAACCTGCGGAAGGATCATTAGAGAGAATTATTACACGTGTTTTCACTAAATAAATTATTAAACGTTATTATTATTATTATTGTTATCAAGATAATCTAAAATCAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTATTATGAATTGCAGATTTTCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTGTGGTATTCCACAGGGCATGCCTGTTTGAGCGTCATTTCTCTCTCAAGCTTTTTAGCTTGGTGTTGAGTTTGCTCGGCTTACTTGAAAAAAATATGAGTGTAATTGTTTAGGTTGTACCAAATCTTTTACACAAAACACCATAACAAGTTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGA

//

Name of Depositor SO Suh
Special Collection ATCC
Chain of Custody
ATCC <-- SO Suh
Isolation
Gut of Pallodes sp. (Nitidulidae) ex Hydropus sp., Barro Colorado Island, Panama.
Cross References

Nucleotide (GenBank) : FJ614690 D1/D2 region of 28S rRNA gene

Nucleotide (GenBank) : FJ623620 ITS including 5.8S rRNA gene

References

Suh SO, Nguyen NH, Blackwell M. A yeast clade near Candida kruisii uncovered: nine novel Candida species associated with basidioma-feeding beetles. Mycol. Res. 110: 1379-1394, 2006.

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation