lambda32 (ATCC® 65892)

Organism: Homo sapiens, human  /  Clone Type: Clone  /  Depositors: IB Dawid, P Bray

Designations lambda32
GenBank Number


Species Homo sapiens, human
Depositors IB Dawid, P Bray
The predicted product size is (bp): 184. The observed product size is (bp): 184.
Construct size (kb): 48.0
DNA: genomic
Insert lengths(kb): 16.5
Tissue: placenta
Gene product: zinc finger protein 61 [ZNF61]
Insert Size (kb) 16.5
Biosafety Level 1
Shipping Information Distributed: freeze-dried bacteria-free lysate
Restriction digests of the clone give the following sizes (kb): EcoRI--22.4, 16.0, 9.6.
Verified to contain the correct insert sequence using the following oligonucleotides (5'-3'): TCAGCCACAGCTCCTCACTCAGCC and GACGAGCTGTGACTGAATGCCTTGC.
The predicted product size is (bp): 184. The observed product size is (bp): 184.

Lichter P, et al. Clustering of C2-H2 zinc finger motif sequences within telomeric and fragile site regions of human chromosomes. Genomics 13: 999-1007, 1992. PubMed: 1505991

Product Sheet
Product Sheet
Product Sheet