Candida albicans (Robin) Berkhout (ATCC® 64548)

Strain Designations: D-1  /  Product Format: freeze-dried

Permits and Restrictions

View Permits

Deposited As Candida albicans (Robin) Berkhout, anamorph
Strain Designations D-1
Application
control strain for experimental infection in mice
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format freeze-dried
Type Strain no
Preceptrol® no
Comments
MIC testing
fluconazole-sensitive
Morphology After 2 days on Emmons’ modification of Sabouraud’s medium at 25°C, colony is white, butyrous, smooth. Yeast cells globose to ellipsoid, in chains and clusters. Pseudohyphae abundant, well-differentiated, with blastoconidia.
Medium ATCC® Medium 28: Emmons' modification of Sabouraud's agar
ATCC® Medium 200: YM agar or YM broth
ATCC® Medium 1245: YEPD
Growth Conditions
Temperature: 25°C to 30°C
Atmosphere: Typical aerobic 
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal   transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence.

AGGATCATTACTGATTTGCTTAATTGCACCACATGTGTTTTTCTTTGAAACAAACTTGCTTTGGCGGTGGGCCCAGCCTGCCGCCAGAGGTCTAAACTTACAACCAATTTTTTATCAACTTGTCACACCAGATTATTACTAATAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATATGAATTGCAGATATTCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTCTGGTATTCCGGAGGGCATGCCTGTTTGAGCGTCGTTTCTCCCTCAAACCGCTGGGTTTGGTGTTGAGCAATACGACTTGGGTTTGCTTGAAAGACGGTAGTGGTAAGGCGGGATCGCTTTGACAATGGCTTAGGTCTAACCAAAAACATTGCTTGCGGCGGTAACGTCCACCACGTATATCTTCAAACTTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAG

 

D1D2 region of the 26S ribosomal RNA gene.

CATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTCAGTAGCGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCGTCTTTGGCGTCCGAGTTGTAATTTGAAGAAGGTATCTTTGGGCCCGGCTCTTGTCTATGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTGCGATGAGATGACCCGGGTCTGTGTAAAGTTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGCTTGAGATCAGACTTGGTATTTTGCATGCTGCTCTCTCGGGGGCGGCCGCTGCGGTTTACCGGGCCAGCATCGGTTTGGAGCGGCAGGATAATGGCGGAGGAATGTGGCACGGCTTCTGCTGTGTGTTATAGCCTCTGACGATACTGCCAGCCTAGACCGAGGACTGCGGTTTTTAACCTAGGATGTTGGCATAATGATCTTAAGTCGC
Morphology After 2 days on Emmons’ modification of Sabouraud’s medium at 25°C, colony is white, butyrous, smooth. Yeast cells globose to ellipsoid, in chains and clusters. Pseudohyphae abundant, well-differentiated, with blastoconidia.
Name of Depositor JN Galgiani
References

Espinel-Ingroff A, et al. Comparison of two alternative microdilution procedures with the National Committee for Clinical Laboratory Standards reference macrodilution method M27-P for in vitro testing of fluconazole-resistant and -susceptible isolates of Candida albicans. J. Clin. Microbiol. 33: 3154-3158, 1995. PubMed: 8586692

Galgiani JN, et al. Comparison of relative susceptibilities of Candida species to three antifungal agents as determined by unstandardized methods. Antimicrob. Agents Chemother. 31: 1343-1347, 1987. PubMed: 3674846

Cermeno-Vivas JR, et al. Pathogenicity of Hansenula anomala in a model of immunocompromised mice. Mycopathologia 144: 67-71, 1999. PubMed: 10481286

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation