Candida albicans (Robin) Berkhout, anamorph (ATCC® 64548)

Strain Designations: D-1  /  Product Format: freeze-dried

Permits Notice: Necessary Permits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Strain Designations D-1
Application
control strain for experimental infection in mice
Biosafety Level 1
Product Format freeze-dried
Type Strain no
Comments
MIC testing
fluconazole-sensitive
Morphology After 2 days on Emmons’ modification of Sabouraud’s medium at 25°C, colony is white, butyrous, smooth. Yeast cells globose to ellipsoid, in chains and clusters. Pseudohyphae abundant, well-differentiated, with blastoconidia.
Medium ATCC® Medium 28: Emmons' modification of Sabouraud's agar
ATCC® Medium 200: YM agar or YM broth
ATCC® Medium 1245: YEPD
Growth Conditions
Temperature: 25°C to 30°C
Atmosphere: Typical aerobic 
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal   transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence.

AGGATCATTACTGATTTGCTTAATTGCACCACATGTGTTTTTCTTTGAAACAAACTTGCTTTGGCGGTGGGCCCAGCCTGCCGCCAGAGGTCTAAACTTACAACCAATTTTTTATCAACTTGTCACACCAGATTATTACTAATAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATATGAATTGCAGATATTCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTCTGGTATTCCGGAGGGCATGCCTGTTTGAGCGTCGTTTCTCCCTCAAACCGCTGGGTTTGGTGTTGAGCAATACGACTTGGGTTTGCTTGAAAGACGGTAGTGGTAAGGCGGGATCGCTTTGACAATGGCTTAGGTCTAACCAAAAACATTGCTTGCGGCGGTAACGTCCACCACGTATATCTTCAAACTTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAG

 

D1D2 region of the 26S ribosomal RNA gene.

CATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTCAGTAGCGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCGTCTTTGGCGTCCGAGTTGTAATTTGAAGAAGGTATCTTTGGGCCCGGCTCTTGTCTATGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTGCGATGAGATGACCCGGGTCTGTGTAAAGTTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGCTTGAGATCAGACTTGGTATTTTGCATGCTGCTCTCTCGGGGGCGGCCGCTGCGGTTTACCGGGCCAGCATCGGTTTGGAGCGGCAGGATAATGGCGGAGGAATGTGGCACGGCTTCTGCTGTGTGTTATAGCCTCTGACGATACTGCCAGCCTAGACCGAGGACTGCGGTTTTTAACCTAGGATGTTGGCATAATGATCTTAAGTCGC
Morphology After 2 days on Emmons’ modification of Sabouraud’s medium at 25°C, colony is white, butyrous, smooth. Yeast cells globose to ellipsoid, in chains and clusters. Pseudohyphae abundant, well-differentiated, with blastoconidia.
Name of Depositor JN Galgiani
References

Espinel-Ingroff A, et al. Comparison of two alternative microdilution procedures with the National Committee for Clinical Laboratory Standards reference macrodilution method M27-P for in vitro testing of fluconazole-resistant and -susceptible isolates of Candida albicans. J. Clin. Microbiol. 33: 3154-3158, 1995. PubMed: 8586692

Galgiani JN, et al. Comparison of relative susceptibilities of Candida species to three antifungal agents as determined by unstandardized methods. Antimicrob. Agents Chemother. 31: 1343-1347, 1987. PubMed: 3674846

Cermeno-Vivas JR, et al. Pathogenicity of Hansenula anomala in a model of immunocompromised mice. Mycopathologia 144: 67-71, 1999. PubMed: 10481286

Permits Notice: Necessary Permits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation