Saccharomyces cerevisiae Meyen ex E.C. Hansen (ATCC® 24860)

Alternate State: Candida robusta Diddens et Lodder  /  Strain Designations: 641a [VTT C-79096]  /  Product Format: freeze-dried

Permits and Restrictions

View Permits

Deposited As Saccharomyces cerevisiae Hansen, teleomorph
Classification Saccharomycetes, Saccharomycetidae, Saccharomycetales, Saccharomycetaceae, Saccharomycetaceae, Saccharomyces, cerevisiae
Strain Designations 641a [VTT C-79096]
Alternate State Candida robusta Diddens et Lodder
Application
ferments xylulose
produces transaldolase
Biosafety Level 1
Product Format freeze-dried
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Comments
wild-type diploid, high ethanol-tolerance
Morphology After 2 days on YM agar at 30°C, colonies off-white, smooth, butyrous. Cells ovoidal, single, in pairs or clusters. Pseudohyphae not observed.
Medium Medium 200: YM agar or YM broth
Medium 28: Emmons' modification of Sabouraud's agar
Medium 1245: YEPD
Growth Conditions
Temperature: 30°C
Atmsophere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

AAGGATCATTAAAGAAATTTAATAATTTTGAAAATGGATTTTTTTGTTTTGGCAAGAGCATGAGAGCTTTTACTGGGCAAGAAGACAAGAGATGGAGAGTCCAGCCGGGCCTGCGCTTAAGTGCGCGGTCTTGCTAGGCTTGTAAGTTTCTTTCTTGCTATTCCAAACGGTGAGAGATTTCTGTGCTTTTGTTATAGGACAATTAAAACCGTTTCAATACAACACACTGTGGAGTTTTCATATCTTTGCAACTTTTTCTTTGGGCATTCGAGCAATCGGGGCCCAGAGGTAACAAACACAAACAATTTTATCTATTCATTAAATTTTTGTCAAAAACAAGAATTTTCGTAACTGGAAATTTTAAAATATTAAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCAGGGGGCATGCCTGTTTGAGCGTCATTTCCTTCTCAAACATTCTGTTTGGTAGTGAGTGATACTCTTTGGAGTTAACTTGAAATTGCTGGCCTTTTCATTGGATGTTTTTTTTCCAAAGAGAGGTTTCTCTGCGTGCTTGAGGTATAATGCAAGTACGGTCGTTTTAGGTTTTACCAACTGCGGCTAATCTTTTTTTATACTGAGCGTATTGGAACGTTATCGATAAGAAGAGAGCGTCTAGGCGAACAATGTTCTTAAAGTTTGACCTCAAATCAGGTAGGAGTACCCGCTGAACTTAAG


D1D2 region of the 28S ribosomal RNA gene

CATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGTACCTTCGGTGCCCGAGTTGTAATTTGGAGAGGGCAACTTTGGGGCCGTTCCTTGTCTATGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTGTGGCGAGGAGTGCGGTTCTTTGTAAAGTGCCTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGCATTTGATCAGACATGGTGTTTTGTGCCCTCTGCTCCTTGTGGGTAGGGGAATCTCGCATTTCACTGGGCCAGCATCAGTTTTGGTGGCAGGATAAATCCATAGGAATGTAGCTTGCCTCGGTAAGTATTATAGCCTGTGGGAATACTGCCAGCTGGGACTGAGGACTGCGACGTAAGTCAAGGATGCTGGCATAATGGTTATATGCCGC

Morphology After 2 days on YM agar at 30°C, colonies off-white, smooth, butyrous. Cells ovoidal, single, in pairs or clusters. Pseudohyphae not observed.
Name of Depositor A Ali
Chain of Custody
ATCC <-- A Ali <-- RB Drysdale
References

McMurrough I, et al. Selection of high ethanol-yielding Saccharomyces. I. Ethanol tolerance and the effect of training in Saccharomyces cerevisiae Hansen. Folia Microbiol. 16: 346-349, 1971. PubMed: 5125362

Senac T, Hahn-Hagerdal B. Effects of increased transaldolase activity on D-xylulose and D-glucose metabolism in Saccharomyces cerevisiae cell extracts. Appl. Environ. Microbiol. 57: 1701-1706, 1991. PubMed: 1831338

Jeppsson H, et al. Xylulose and glucose fermentation by Saccharomyces cerevisiae in chemostat culture. Appl. Environ. Microbiol. 62: 1705-1709, 1996. PubMed: 8633869

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation