Aspergillus terreus Thom, anamorph (ATCC® MYA-4898)

Strain Designations: IFO 7078  /  Product Format: frozen

Permits and Restrictions

View Permits

Strain Designations IFO 7078
Application
Produces lovastatin
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format frozen
Type Strain no
Preceptrol® no
Morphology On PDA medium at 25°C after 12 days, mycelium white to pale yellow, dense, in tufts. Conidia tan to light brown with a powdery texture. Turns media bright yellow. Reverse reddish brown. Conidial heads clavate to pyriform, vesicles 10.5-15 X 9-13.5 µm. Conidia reddish brown in mass, globose to subglobose,3.75-4.5 X 3-4.5 µm.
Medium ATCC® Medium 200: YM agar or YM broth
ATCC® Medium 336: Potato dextrose agar (PDA)
ATCC® Medium 324: Malt extract agar
Growth Conditions
Temperature: 20°C to 25°C
Atmosphere: Typical Aerobic
Sequenced Data
>18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence; GenBank number JX174057:

AAGGATCATTACCGAGTGCGGGTCTTTATGGCCCAACCTCCCACCCGTGACTATTGTACCTTGTTGCTTCGGCGGGCCCGCCAGCGTTTGCTGGCCGCCGGGGGGCGACTCGCCCCCGGGCCCGTGCCCGCCGGAGACCCCAACATGAACCCTGTTCTGAAAGCTTGCAGTCTGAGTGTGATTCTTTGCAATCAGTTAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAACTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCCCGGCTTGTGTGTTGGGCCCTCGTCCCCCGGCTCCCGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGGTCCTCGAGCGTATGGGGCTTCGTCTTCCGCTCCGTAGGCCCGGCCGGCGCCCGCCGACGCATTTATTTGCAACTTGTTTTTTTCCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAG
>D1D2 region of the 28S ribosomal RNA gene; GenBank number JX174046:

ATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAAGAGCTCAAATTTGAAAGCTGGCTCCTTCGGGGTCCGCATTGTAATTTGCAGAGGATGCTTCGGGTGCAGCCCCCGTCTAAGTGCCCTGGAACGGGCCGTCATAGAGGGTGAGAATCCCGTATGGGGCGGGGTGTCTGCGTCCGTGTGAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATACTGGCCGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTCGCTCGCGGGGTTCAGCCGGGCTTCGGCCCGGTGTACTTCCCCGCGGGCGGGCCAGCGTCGGTTTGGGCGGCCGGTCAAAGGCCTCCGGAATGTAGCGCCCTTCGGGGCGCCTTATAGCCGGGGGTGCAATGCGGCCAGCCTGGACCGAGGAACGCGCTTCGGCACGGACGCTGGCATAATGGTTGTAAACGA
Morphology On PDA medium at 25°C after 12 days, mycelium white to pale yellow, dense, in tufts. Conidia tan to light brown with a powdery texture. Turns media bright yellow. Reverse reddish brown. Conidial heads clavate to pyriform, vesicles 10.5-15 X 9-13.5 µm. Conidia reddish brown in mass, globose to subglobose,3.75-4.5 X 3-4.5 µm.
Name of Depositor G Szakacs
Special Collection ATCC
Chain of Custody
ATCC <-- G Szakacs
Cross References

Nucleotide (GenBank) : JX174057 ITS including 5.8S rRNA gene

Nucleotide (GenBank) : JX174046 D1/D2 region of 28S rRNA gene

References

Szakacs G, et al. Production of lovastatin by a wild strain of Aspergillus terrus. Biotechnol. Lett. 20(4): 411-415, 1998.

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation