Meredithblackwellia eburnea Toome et Aime (ATCC® MYA-4884)

Strain Designations: MCA 4105 [CBS 12589, NRRL Y-48821]  /  Product Format: frozen

Permits and Restrictions

View Permits

Classification Microbotryomycetes, Microbotryomycetes incertae sedis, Kriegeriaceae, Meredithblackwellia, eburnea
Strain Designations MCA 4105 [CBS 12589, NRRL Y-48821]
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain yes
Preceptrol® no
Genome Sequenced Strain

Yes

Comments Genome sequencing strain (the Joint Genome Institute at the Department of Energy, USA)
Morphology On YM medium at 25°C after 6 days, colonies creamy white to dingy white, smooth, raised, dull, with an entire margin. Cells elongated ellipsoidal, smooth, containing oil droplets, 13.5-16.5 µm X 3-5.25 µm.
Medium ATCC® Medium 28: Emmons' modification of Sabouraud's agar
ATCC® Medium 200: YM agar or YM broth
ATCC® Medium 1245: YEPD
Growth Conditions
Temperature: 20°C to 25°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence; GenBank number JQ906777:

AAGGATCATTAGTGAATTTTAGGGCGTCGTTTTTAACAACGAGCCTGACCTCCACTTCTAACACTGTGCACTTTGCTTTGGCGCTGAAAACGAGAATTGTTGTGCTTAACGGCCCTTTTTTCAAATGAAGCCCTTAGTCTTTTTTTACTTTAAACATTTGAAGTCAAAGTATGTAACCAAGTTTATAAAACAAAAAAAAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGTGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCATCTTGCGCTCTCTGGTATTCCGGAGAGCATGTCTGTTTGAGTGTCATGAACTCTTCAACCCTCCAATTTCTAGTAGATTGCGAGGAGTTTGGATTTTGAGCGTTTTGCTAATCTTTAGATTAGCTCGTTCGTAATGCATTAGCCTCTCGAATTCGATTTCGGATTGACTCAGTGTAATAGACTATTCGCTGAGGACACTTTTTACTAAGTGGCCGAATGAGAAACTGTTTAGAAGCTTCTAAAGCAAGTTTGATTAGTCAAATCTTCAATTTAGACCTCAGATCAGGCAGGATTACCCGCTGAACTTAAG


D1D2 region of the 28S ribosomal RNA gene; GenBank number JQ906775:

ATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAATTTGTAATCTGGCACTTTCAGTGTCCGAGTTGTAATCTCGAGAAGTGTTTTCCGCGCTAGACTGCATACAAGTCTGTTGGAATACAGCGTCATAGTGGTGAGAACCCCGTACCTGATGCAGATGCCTAGTGCTTTGTGATACACTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAATTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAACAGTACGTGAAATTGTTGGAAGGGAAACGCTTGAAGTCAGACTTGCTATCTGGAATTCAGCCGCAAGGCGTATTTTTCAGTTCGCAGGCCAGCATCAGTTTTTGGGGGTGGAAAAGGGTAATTGGAATGTGGCAACTCCGGTTGTGTTATAGCCTTTTACTGGATTCACCTTTGGGGACTGAGGAACGCAGTGTGCTTTTTGCAAGGCCCTCGGGCTTATCACACTTAGGATGCTGGTGGAATGGCTTTAAACGA

Morphology On YM medium at 25°C after 6 days, colonies creamy white to dingy white, smooth, raised, dull, with an entire margin. Cells elongated ellipsoidal, smooth, containing oil droplets, 13.5-16.5 µm X 3-5.25 µm.
Name of Depositor M Toome
Special Collection ATCC
Chain of Custody
ATCC <-- MC Aime, M Toome
Isolation
Fern leaf, Pakaraima Mountains, Guyana.
Cross References

Nucleotide (GenBank) : JQ906777 ITS including 5.8S rRNA gene

Nucleotide (GenBank) : JQ906775 D1/D2 region of 28S rRNA gene

References

Toome M, et al. Meredithblackwellia eburnea gen. et sp. nov., Kriegeriaceae fam. nov. and Kriegeriales ord. nov.—toward resolving higher-level classification in Microbotryomycetes. Mycologia 105: 486–495, 2013. PubMed: 23099516

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation