Microascus cirrosus Curzi (ATCC® MYA-4885)

Strain Designations: 70024521  /  Product Format: frozen

Strain Designations 70024521
Biosafety Level 2
Product Format frozen
Type Strain no
Preceptrol® no
Comments
clinical isolate
Morphology On potato dextrose medium at 25°C after 13 days, mycelium white to pale pink, very dense, abundant aerial hyphae, velvety to cottony. Conidia ellipsoidal, smooth, 3-5µm X 2-2.5 µm.
Medium ATCC® Medium 336: Potato dextrose agar (PDA)
ATCC® Medium 324: Malt extract agar
Growth Conditions
Temperature: 20°C to 25°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal   transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence; GenBank number JQ906771:

GTCGTAACAAGGTCTCCGTTGGTGAACCAGCGGAGGGATCATTACCGAAGTTACTCTTCATACCCTTTTGTGAACACTACCCCATTGCCGCGCGTTGCCTCGGCGGGGAGGTCCGCGGGGTTGCGCTCCGGCGCTCCCCCCGGGCCCCCGCCGGCCGCGCCGAACTCTTCATTTGCAAAGCGGACTGTATGTTCTGATTATATCTTGAAAAACAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGGCAGCAATCTGCCGGGCATGCCTGTCCGAGCGTCATTTCTGCCCTCGAGCGCGGTTCGGCCCCTAGCGGGCCGTCCGCCGCCCGGTGTTGGGGCGCTGCGGGCCCTCGTGCCCGCAGGCCCTGAAATGAAGTGGCGGTCCCGCCGCGGCGCCCCCTGCGTAGTAGTAAAGCACCTCGCATCGGGTCCCGGCGGAGGCCAGCCGTCGAACCTCTTTCTCTTGATGGTTTGACCTCGGATCAGGTAGGGTTACCCGCTGAACTTAAG

 

D1D2 region of the 28S ribosomal RNA gene; GenBank number JQ906766:

CATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGTCCCCCCGCGGGGCCCGAGTTGTAATTTGAAGAGGATGCTTCTGGCAAGGTGCCGTCCGAGTTCCCTGGAACGGGACGCCGCAGAGGGTGAGAGCCCCGTACGGTCGGACGCCGAGCCTCTGTGAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTAAACCCCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCGACCAGACTCGCGCCCGTCGGATCAGCCGTCGCTCGTCGGCGGCGCACTCCGGCGGGCTCGGGCCAGCATCAGTTCGCCTCGGGGGGAGAAAGGCGGCGGGAATGTGGCTCTACGGAGTGTTATAGCCCGCCGCGTAATACCCCCGGGCGGACTGAGGACCGCGCGTATGCAAGGATGCTGGCGTAATGGTCGTCAGCGA

Morphology On potato dextrose medium at 25°C after 13 days, mycelium white to pale pink, very dense, abundant aerial hyphae, velvety to cottony. Conidia ellipsoidal, smooth, 3-5µm X 2-2.5 µm.
Name of Depositor F Morio
Special Collection ATCC
Chain of Custody
ATCC <-- F Morio
Isolation
Human, Nantes, France.
Cross References

Nucleotide (GenBank) : JQ906771 ITS including 5.8S rRNA gene

GenBank : JQ906766 D1/D2 region of 28S rRNA gene

Nucleotide (GenBank) : JQ906766 D1/D2 region of 28S rRNA gene

References

Miossec C, et al. Fatal invasive infection with fungemia due to Microascus cirrosus after heart and lung transplantation in a patient with cystic fibrosis. J. Clin. Microbiol. 49: 2743-2747, 2011.