Phytophthora ramorum Werres et al. (ATCC® MYA-2949)

Strain Designations: Pr-102  /  Product Format: frozen

Permits Notice: Necessary Permits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
  • USDA APHIS PPQ Permit 526, plant pathogens permit must be obtained and a copy of the permit must be sent to ATCC in advance of shipment. Isolation information for this item is required by USDA. Please check our website or contact Technical Service for assistance. Domestic isolates are easier to obtain than foreign isolates.
Deposited As Phytophthora ramorum
Strain Designations Pr-102
Biosafety Level 1
Product Format frozen
Type Strain yes
Genome Sequenced Strain

Yes

Comments
Genome sequencing strain (the Joint Genome Institute at the Department of Energy, USA).
Pathogen of sudden oak death
Morphology

After 10 days colony with sparse aerial mycelium; chlamydospores abundant. Sporangia abundantly produced; ellipsoid, spindle-shaped or elongate-ovoid.

Medium ATCC® Medium 343: V8 juice agar
Growth Conditions
Temperature: 20.0°C
Sequenced Data
  18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence.

GTATCAAAACCCTTAGTTGGGGGCTTCTGTTCGGCTGGCTTCGGCTGGCTGGGCGGCGGCTCTATCATGGCGAGCGCTTGAGCCTTCGGGTCTGAGCTAGTAGCCCACTTTTTAAACCCATTCCTAAATACTGAATATACTGTGGGGACGAAAGTCTCTGCTTTTAACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCCTGTATCAGTGTCCGTACATCAAACTTGCCTCCCTTCCTTCCGTGTAGTCGGTGGATGGGGACGTGCAGACGTGAAGTGTCTTGCGATTGGTCTTCGGGCCGGCTGCGAGTCCTTTGAAATGTACAGAACTGTACTTCTCTTTGCTCGAAAAGCATGACGTTGTTGGTTGTGGAGGCTGCCCGTGTGGCCAGTCGGCGACCGGTTTGTCTGCTGCGGCGTTTAATGGAGGAGTGTTCGATTCGCGGTATGGTTAGCTTCGGCTGAACAATGCGCTTATTGGATGCTTTTTCTGCTGTGGCGGTAATGACTGGTGAACCGTAGCTGTGCAGGGCTTGGCTTTTGAATCGACGGTGTTGTGCGAAGTAGAGTGGCGGTTCGGCGCAAGCTGGGCTGTCGAGGGTCGATCCATTTGGGAAACTTGTGTTGGCGGCTTCGGCTGCTGGCATCTCAA

Morphology

After 10 days colony with sparse aerial mycelium; chlamydospores abundant. Sporangia abundantly produced; ellipsoid, spindle-shaped or elongate-ovoid.

Name of Depositor D Rizzo, A Wickland
Special Collection NSF - Mycology
Chain of Custody
D Rizzo
A Wickland
Isolation
plant
Marin Co. California, United States
Geographical Isolation China Camp State Park
Cross References

Nucleotide (GenBank) : AAQX01000000 Phytophthora ramorum strain Pr102, whole genome shotgun sequencing project.

References

Tyler BM, et al. Phytophora genome sequence uncover evolutionary origins and mechanisms of pathogenesis. Science 313: 1261-6, 2006.

Permits Notice: Necessary Permits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
  • USDA APHIS PPQ Permit 526, plant pathogens permit must be obtained and a copy of the permit must be sent to ATCC in advance of shipment. Isolation information for this item is required by USDA. Please check our website or contact Technical Service for assistance. Domestic isolates are easier to obtain than foreign isolates.
Basic Documentation