Aspergillus fumigatus Fresenius, anamorph (ATCC® 1022)

Alternate State: Sartorya fumigata Vuillemin, teleomorph  /  Strain Designations: NRRL 163 [118, CBS 133.61, IMI 16152, LSHB Ac71, NCTC 982, QM 1981, WB 163]  /  Product Format: freeze-dried

Permits Notice: Necessary Permits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Strain Designations NRRL 163 [118, CBS 133.61, IMI 16152, LSHB Ac71, NCTC 982, QM 1981, WB 163]
Alternate State Sartorya fumigata Vuillemin, teleomorph
Application
quality control strain
Biomedical Research and Development Material
Emerging infectious disease research
Opportunistic pathogen research
Respiratory research
Biosafety Level 2
Product Format freeze-dried
Type Strain yes
Intended Use
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

CCCTTTGTACACACCGCCCGTCGCTACTACCGATTGAATGGCTCGGTGAGGCCTTCGGACTGGCTCAGGGGAGTTGGCAACGACTCCCCAGAGCCGGAAAGTTGGTCAAACCCGGTCATTTAGAGGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTACCGAGTGAGGGCCCTCTGGGTCCAACCTCCCACCCGTGTCTATCGTACCTTGTTGCTTCGGCGGGCCCGCCGTTTCGACGGCCGCCGGGGAGGCCTTGCGCCCCCGGGCCCGCGCCCGCCGAAGACCCCAACATGAACGCTGTTCTGAAAGTATGCAGTCTGAGTTGATTATCGTAATCAGTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCACGGCTTGTGTGTTGGGCCCCCGTCCCCCTCTCCCGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGGTCCTCGAGCGTATGGGGCTTTGTCACCTGCTCTGTAGGCCCGGCCGGCGCCAGCCGACACCCAACTTTATTTTTCTAAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAAGAGCTCAAATTTGAAAGCTGGCCCCTTCGGGGTCCGCGTTGTAATTTGCAGAGG

Name of Depositor NRRL
Chain of Custody
ATCC <-- NRRL <-- C Thom 118
Isolation
lung of chicken, Connecticut
Cross References

Nucleotide (GenBank) : HQ026746 ITS including 5.8S rRNA gene

References

Samson RA, Gams WTypification of the species of Aspergillus and associated teleomorphsIn: Samson RA, Gams WAdvances in Penicillium and Aspergillus systematicsNew YorkPlenum Presspp. 31-54, 1985

Applied Biosystems, MicroSeq Food Panel.

Permits Notice: Necessary Permits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation
Other Documentation