Malassezia globosa Midgley, E. Guého et J. Guillot (ATCC® MYA-4889)

Strain Designations: M15  /  Product Format: frozen

Permits and Restrictions

View Permits

Strain Designations M15
Biosafety Level 2
Product Format frozen
Type Strain no
Preceptrol® no
Comments
Clinical isolate
Lipid dependent
Morphology On modified Leeming & Notman medium at 30°C after 7 days, colonies creamy white to dingy white, raised, smooth to wrinkled, with a lobed margin. Cells globose to subglobose, smooth, 5.25-7.5 X 4.5-6.75 µm. Pseudohyphae not observed.
Medium ATCC® Medium 2737: Modified Leeming & Notman Agar (MLNA)
ATCC® Medium 2693: modified Dixon (mDixon)
Growth Conditions
Temperature: 30°C to 34°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal   transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence; GenBank number JQ958303:

TACAGACGTACAATAAGTGTGTCTCTGGCGGCTCGTATCCACTATACATCCATAAACCCGTGTGCACTGTTAAGGAGTAAGAAAGAAGGGGAGGGAGAGAGTGCATGTGCTTTGCATATAACTCTCTCTCTTTCTCTTCCTTTCTCTCTCTGGTTAATTACACAAACTCGTATGGATTTGTATGAACGTGAGATATATCGTTGGACCGTCACTGGCCAACAAATATAACACAACTTTCGACAACGGATCTCTTGGTTCTCCCATCGATGAAGAACGCAGCGAAACGCGATAGGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCTATGGTATTCCGTAGAGCATGCCTGTTTGAGTGCCGTGAATTCTCCCATCCCAAGCGGTTTTTATCAAAGAATTGCTAGGCGAAGGGGTTGAGATGGGCGTTGTTATAACTGCTTTTCTTCTCTAGAAAAGCTCGCCCGAAAAACAGCTAACGCCTCTGGGCCACTTTGCATCCGCTTCTCTGAGGGGAGAAGCGGCCAAGCGCGCTCTGATCATCAGGCATAGCATGATACGTCATTTGCTATGCTGTAGGAGAGCATTTGGTTGTGGTTATACCGCGTGCGTTATTTTTTTTTT

 

D1D2 region of the 28S ribosomal RNA gene; GenBank number JQ958301:

ATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAACGGCGAGCGAAGCGGGAAGAGCTCAAATTTGAAAGCTGGCACCTCCGGTGTCCGCGTTGTAATCTCGAGACGTGTTTTCCGTGCGGCTCTATGGACAAGTCCCTTGGAATAGGGCATCGTAGAGGGTGAGAATCCCGTACTTGCCATGGAAGAACCGTGCTTTGCGATACACGCTCTAAGAGTCGAGTTGTTTGGGATTGCAGCTCAAAATGGGTGGTAGACTCCATCTAAAGCTAAATATCGGGGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAGTACGTGAAATTGTCGAAAGGGAAGCACTTGAAGTCAGCCATGCTGCTTGAGACTCAGCCTGGCCTTTGGGCTTGGTGTATTTCTCGGTGGCAAGCCAGCATTGGTTTGGGTCGTCGGAGAAGCGCATAGGGAATGTAGCGTCTCCGGACGTGTTATAGCCTTATGCAGGATACGACGACCTGGATCAAGGAACGCAGTGTGCCCTCTGGGCGGGTCTTCGGACACCTTCACACTTAGGATGCTGGCGTAATGGCTTTAAGTGG

Morphology On modified Leeming & Notman medium at 30°C after 7 days, colonies creamy white to dingy white, raised, smooth to wrinkled, with a lobed margin. Cells globose to subglobose, smooth, 5.25-7.5 X 4.5-6.75 µm. Pseudohyphae not observed.
Name of Depositor A Zinkeviciene
Special Collection ATCC
Chain of Custody
ATCC <-- A Zinkeviciene
Isolation
Patient with atopic dermatitis, Vilnius, Lithuania
Cross References

Nucleotide (GenBank) : JQ958303 ITS including 5.8S rRNA gene

Nucleotide (GenBank) : JQ958301 D1/D2 region of 28S rRNA gene

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation