Candida albicans (Robin) Berkhout, anamorph (ATCC® MYA-427™) Strain Designations: A39 [DUMC 136.97] / Product Format: frozen General Information Characteristics Culture Method Specifications History Documentation Print Email Share Share this product Facebook Twitter Google+ Permits These permits may be required for shipping this product: Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment. Strain Designations A39 [DUMC 136.97] Application negative control in differential gene expression studies Biosafety Level 1 Product Format frozen Storage Conditions Frozen: -80°C or colderFreeze-Dried: 2°C to 8°C Type Strain no Comments negative control in differential gene expression studies Morphology Colonies after 3 days cream-colored, dull, often becoming wrinkled with a mycelial border on prolonged incubation. Yeast cells globose to short-ovoid, hyaline, 2-7 x 3-8.5 µm, single or budding, occasionally forming short chains. Medium ATCC® Medium 1245: YEPD Growth Conditions Temperature: 25°C to 30°CAtmosphere: Typical aerobic Sequenced Data D1D2 region of the 28S ribosomal RNA gene:AACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTCAGTAGCGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCGTCTTTGGCGTCCGAGTTGTAATTTGAAGAAGGTATCTTTGGGCCCGGCTCTTGTCTATGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTGCGATGAGATGACCCGGGTCTGTGTAAAGTTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGCTTGAGATCAGACTTGGTATTTTGCATGTTGCTCTCTCGGGGGCGGCCGCTGCGGTTTACCGGGCCAGCATCGGTTTGGAGCGGCAGGATAATGGCGGAGGAATGTGGCACGGCTTCTGCTGTGTGTTATAGCCTCTGACGATACTGCCAGCCTAGACCGAGGACTGCGGTTTTTACCTAGGATGTTGGCATAATGATCTTAAGTCGCCCGTCTTG Morphology Colonies after 3 days cream-colored, dull, often becoming wrinkled with a mycelial border on prolonged incubation. Yeast cells globose to short-ovoid, hyaline, 2-7 x 3-8.5 µm, single or budding, occasionally forming short chains. Name of Depositor JR Perfect Special Collection NCRR Contract Isolation human blood, Belgium References del Poeta M, et al. Cryptococcus neoformans differential gene expression detected in vitro and in vivo with green fluorescent protein. Infect. Immun. 67: 1812-1820, 1999. PubMed: 10085022 John R Perfect, personal communication Permits These permits may be required for shipping this product: Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment. Basic Documentation Product Sheet Certificate of Analysis MSDS Other Documentation Microbial Characterization Data