Zygosaccharomyces parabailii Suh et al. (ATCC® MYA-4549)

Strain Designations: VITEK 301705 [MUCL 51627]  /  Product Format: frozen

Deposited As Zygosaccharomyces bailii (Lindner) Guilliermond
Strain Designations VITEK 301705 [MUCL 51627]
Application
quality control strain
Biosafety Level 1
Product Format frozen
Type Strain no
Preceptrol® no
Comments
Quality control strain for VITEK2 Yeast Identification Card.
The strain differs from the type strain of Z. bailii at 4 nucleotide positions within the D1D2 region of LSU rDNA, and at 38 nucleotide positions in the ITS region.
Medium ATCC® Medium 200: YM agar or YM broth
ATCC® Medium 28: Emmons' modification of Sabouraud's agar
ATCC® Medium 1245: YEPD
Growth Conditions
Temperature: 24°C to 26°C
Atmosphere: Typical aerobic
Sequenced Data
LSU rDNA of MYA-4549

ATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGTACCTTCGGTGCCCGAGTTGTAATTTGTAGAAGGCGACTCTGGGGCTGGTCCTTGTCTATGTTCCTTGGAACAGGACGTCATGGAGGGTGAAAATCCCGTATGGCGAGGATCCCAGTTCTTTGTAGAGTGCCTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGCATTTGATCAGACATGGTGTTTTGCGCCCCTCGCCTCTCGTGGGTGGGGGAATCTCGCAGCTCACTGGGCCAGCATCAGTTTTGGCGGCAGGATAAATCCCTGGGAATGTAGCTCTACCACTTCGTGGCGGACGAACTTATAGTCCAGGGGAATACTGCCAGCTGGGACTGAGGAATGCGACTTTTTTAGTCAAGGATGCTGGCATAATGGTTATATGCCGC


ITS of MYA-4549

TTTCCGTAGGTGAACCTGCGGAAGGATCATTATAGAAAAATTTCTGATTGACGAGTCTGGAGCAGTTGTGTTCTTTCTGTTTTTTTTAAGGCCTGCGCTTAATTGCGCGGTCTAGAGCGGAGGGAGTTAAGCATAGTTGCTTTGGCTTTCAATTTACACACAGTGGAGTTTCTACTTTTTTTATTCTTCTTTGGGAGGATGGGTTCGTCCCGCTTCCAGAGGTAAACACAAACAATTTTTTTTATTTTATTTTATTTTATTATTATAATAATAATAATACAGTCAAAACGAATACTAAAACAAAAAATATTCAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCAGGGGGCATGCCTGTTTGAGCGTCATTTCCTTCTCAAACATTCGTGTTTGGTAGTGAGTGATACTCTGTTTTATTATTTGGGTTAACTTGAAATTGCAAGCCTTTTGGGGACGCGTGTGGGTGAGTTTTAGGCGGAAACGTCTTGCTCTCCTCTTTCCTAACCAAATGTCGTATTAGGTTTTACCGACTCCGACAGACGGGACTAGGAGATTGGGTGAGTGATAGCAATATCGAGCTCTGCCTAATTTTTTTTTTGCGCGCCTTGGGCAAACAATACTCTCAAAGTTTGACCTCAAATCAGGTAGGATTACCCGCTGAACTTAAGCATATCAATAAGC

Name of Depositor bioMerieux, Inc.
Special Collection ATCC
Chain of Custody
ATCC <-- bioMerieux, Inc.
Cross References

Nucleotide (GenBank) : KC678106 RNA polymerase II largest subunit (RPB1) gene

Nucleotide (GenBank) : KC678081 polymerase II second largest subunit (RPB2) gene

Nucleotide (GenBank) : FJ914902 D1/D2 region of 28S rRNA gene

Nucleotide (GenBank) : FJ914883 ITS including 5.8S rRNA gene

References

Suh SO, et al. Proposal of Zygosaccharomyces parabailii sp. nov. and Zygosaccharomyces pseudobailii sp. nov., two new species closely related to Zygosaccharomyces bailii. Int. J. Syst. Evol. Microbiol. 63: 1922-1929, 2013. PubMed: 23524351

VITEK 2 YST Comprehensive QC Set. bioMerieux.