Penicillium chrysogenum Thom, anamorph (ATCC® 11709)

Strain Designations: Wis. 49-133 [NRRL 2272]  /  Product Format: freeze-dried

Strain Designations Wis. 49-133 [NRRL 2272]
Application
Produces penicillin
Transformations of uleine
Pharmaceutical and Personal Care
Biosafety Level 1
Product Format freeze-dried
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Comments
High-yielding, sporulating, penicillin strain
The species identity has been confirmed by sequence comparison of the ITS region and beta-tubulin gene.
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

TATTGATATGCTTAAGTTCAGCGGGTATCCCTACCTGATCCGAGGTCAACCTGGATAAAAATTTGGGTTGATCGGCAAGCGCCGGCCGGGCCTACAGAGCGGGTGACAAAGCCCCATACGCTCGAGGACCGGACGCGGTGCCGCCGCTGCCTTTCGGGCCCGTCCCCCGGGATCGGAGGACGGGGCCCAACACACAAGCCGTGCTTGAGGGCAGAAATGACGCTCGGACAGGCATGCCCCCCGGAATACCAGGGGGCGCAATGTGCGTTCAAAGACTCGATGATTCACTGAATTTGCAATTCACATTACGTATCGCATTTCGCTGCGTTCTTCATCGATGCCGGAACCAAGAGATCCGTTGTTGAAAGTTTTAAATAATTTATATTTTCACTCAGACTACAATCTTCAGACAGAGTTCGAGGGTGTCTTCGGCGGGCGCGGGCCCGGGGGCGTAAGCCCCCCGGCGGCCAGTTAAGGCGGGCCCGCCGAAGCAACAAGGTAAAATAAACACGGGTGGGAGGTTGGACCCAGAGGGCCCTCACTCGGTAATGATCCTTCCGC


beta-tubulin gene

CGCCGTGAGGCCGAGGGCTGTGACTGCCTCCAGGGTTTCCAGATCACCCACTCCCTGGGTGGTGGTACCGGTGCCGGTATGGGTACACTCCTGATCTCGAAGATCCGTGAGGAGTTCCCCGACCGTATGATGGCCACTTTCTCCGTCGTCCCCTCCCCCAAGGTCTCCGACACCGTTGTTGAGCCTTACAACGCTACCCTCTCCGTTCACCAGCTTGTTGAGCACTCTGACGAGACTTTCTGTATCGATAACGAGGTATGAAACGCGGGGAAATACTGACATGAAGAATACTGACAATATTAGGCTCTCTACGACATTTGCATGCGTACCCTCAAGCTCCCCCAGCCTTCCTACGGTGACCTGAACCACCTCGTCTCCGCCGTCATGTCCGGTGTGACCACCTCCCTTCGTTTCCCCGGTCAGCTCAACTCCGATCTTCGCAAGCTCGCCGTCAACATGGTTCCCTTCCCTCGTCTGCACTTCTTCATGGTCGGCTTCGCTCCCCTGACCAGCCGTGGTGGCTACTCTTACCGCCAGGTCAACGTCCCCGAGTTGACCCAGCAGATGTTCGACCCCAAGAACATGATGGCTGCCTCCGACTTCCGTAACGGCCGCTACCTCACTTGCTCCGCTCTGTTCCGCGGTAAGGTCTCCATGAAGGAGGTTGAGGACCAGATGCGCAACATCCAGAACAAGAACCAGAGCTACTTCGTTGAGTGGATCCCCAACAACGTCCAGACCGCTCTGTGCTCCGTTCCCCCCCGTGGCCTCAAGATGTCTTCCACCTTCGTCGGTAACTCCACCTCCATCCAGGAGCTCTTCAAGCGTGTCGGCGACCAGTTCA

Name of Depositor MP Backus
Isolation
Selected from Wis. 48-701, ATCC 11707, after N-mustard exposure
References

Borris RP, Cordell GA. Studies on the uleine alkaloids. III. Some microbial transformations of uleine. J. Nat. Prod. 46: 211-217, 1983.

Backus MP, Stauffer JF. The production and selection of a family of strains in Penicillium chrysogenum. Mycologia 47: 429-463, 1955.

U.S. Pharmacopeia General Chapters: <1072> Disinfectants and Antiseptics. Rockville, MD. USP34-NF29, 2011