Zygosaccharomyces parabailii Suh et al. (ATCC® MYA-4549)

Strain Designations: VITEK 301705 [MUCL 51627]  /  Product Format: frozen

Permits and Restrictions

View Permits

Deposited As Zygosaccharomyces bailii (Lindner) Guilliermond
Strain Designations VITEK 301705 [MUCL 51627]
Application
Quality control strain
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Comments
Quality control strain for VITEK® 2 Yeast Identification Card.
The strain was re-identified as Zygosaccharomyces parabailii based on the multigene sequence comparison.
Medium ATCC® Medium 200: YM agar or YM broth
ATCC® Medium 28: Emmons' modification of Sabouraud's agar
ATCC® Medium 1245: YEPD
Growth Conditions
Temperature: 24°C to 26°C
Atmosphere: Typical aerobic
Sequenced Data
LSU rDNA of MYA-4549

ATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGTACCTTCGGTGCCCGAGTTGTAATTTGTAGAAGGCGACTCTGGGGCTGGTCCTTGTCTATGTTCCTTGGAACAGGACGTCATGGAGGGTGAAAATCCCGTATGGCGAGGATCCCAGTTCTTTGTAGAGTGCCTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGCATTTGATCAGACATGGTGTTTTGCGCCCCTCGCCTCTCGTGGGTGGGGGAATCTCGCAGCTCACTGGGCCAGCATCAGTTTTGGCGGCAGGATAAATCCCTGGGAATGTAGCTCTACCACTTCGTGGCGGACGAACTTATAGTCCAGGGGAATACTGCCAGCTGGGACTGAGGAATGCGACTTTTTTAGTCAAGGATGCTGGCATAATGGTTATATGCCGC


ITS of MYA-4549

TTTCCGTAGGTGAACCTGCGGAAGGATCATTATAGAAAAATTTCTGATTGACGAGTCTGGAGCAGTTGTGTTCTTTCTGTTTTTTTTAAGGCCTGCGCTTAATTGCGCGGTCTAGAGCGGAGGGAGTTAAGCATAGTTGCTTTGGCTTTCAATTTACACACAGTGGAGTTTCTACTTTTTTTATTCTTCTTTGGGAGGATGGGTTCGTCCCGCTTCCAGAGGTAAACACAAACAATTTTTTTTATTTTATTTTATTTTATTATTATAATAATAATAATACAGTCAAAACGAATACTAAAACAAAAAATATTCAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCAGGGGGCATGCCTGTTTGAGCGTCATTTCCTTCTCAAACATTCGTGTTTGGTAGTGAGTGATACTCTGTTTTATTATTTGGGTTAACTTGAAATTGCAAGCCTTTTGGGGACGCGTGTGGGTGAGTTTTAGGCGGAAACGTCTTGCTCTCCTCTTTCCTAACCAAATGTCGTATTAGGTTTTACCGACTCCGACAGACGGGACTAGGAGATTGGGTGAGTGATAGCAATATCGAGCTCTGCCTAATTTTTTTTTTGCGCGCCTTGGGCAAACAATACTCTCAAAGTTTGACCTCAAATCAGGTAGGATTACCCGCTGAACTTAAGCATATCAATAAGC

Name of Depositor bioMerieux, Inc.
Special Collection ATCC
Chain of Custody
ATCC <-- bioMerieux, Inc.
Cross References

Nucleotide (GenBank) : KC678106 RNA polymerase II largest subunit (RPB1) gene

Nucleotide (GenBank) : KC678081 polymerase II second largest subunit (RPB2) gene

Nucleotide (GenBank) : FJ914902 D1/D2 region of 28S rRNA gene

Nucleotide (GenBank) : FJ914883 ITS including 5.8S rRNA gene

References

Suh SO, et al. Proposal of Zygosaccharomyces parabailii sp. nov. and Zygosaccharomyces pseudobailii sp. nov., two new species closely related to Zygosaccharomyces bailii. Int. J. Syst. Evol. Microbiol. 63: 1922-1929, 2013. PubMed: 23524351

VITEK 2 YST Comprehensive QC Set. bioMerieux.

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation