Chaetomium globosum Kunze : Fries

6205 ^™

Download Genome Learn about the ATCC Genome Portal

An ampoule containing viable cells (may include spores and mycelia) suspended in cryoprotectant.

Product category: Fungi
Strain designation: QM 459 [1042.4, CBS 148.51, CBS 161.52, CEB 1218.1, CEB 1218.2, CECT 2701, DSM 1962, IFO 6347, IMI 45550, MUCL 1984, NRRL 1870, UPSC 3159, VTT D-81079]
Type strain: No
Genome sequenced strain: Yes
Isolation source: Stored cotton
Geographical isolation: United States; Washington, DC
Applications: Biocontrol

Quality control

Agricultural research
Product format: Freeze-dried
Storage conditions: 2°C to 8°C

See Additional Product Information

Price: $288.00 EA

Discounts may be available for our fellow nonprofit organizations. Login to see your price.

This item is currently not in stock. We cannot estimate a shipment date for this item.

Documentation

Product sheet

BSL 1

ATCC determines the biosafety level of a material based on our risk assessment as guided by the current edition of Biosafety in Microbiological and Biomedical Laboratories (BMBL), U.S. Department of Health and Human Services. It is your responsibility to understand the hazards associated with the material per your organization’s policies and procedures as well as any other applicable regulations as enforced by your local or national agencies.

ATCC highly recommends that appropriate personal protective equipment is always used when handling vials. For cultures that require storage in liquid nitrogen, it is important to note that some vials may leak when submersed in liquid nitrogen and will slowly fill with liquid nitrogen. Upon thawing, the conversion of the liquid nitrogen back to its gas phase may result in the vial exploding or blowing off its cap with dangerous force creating flying debris. Unless necessary, ATCC recommends that these cultures be stored in the vapor phase of liquid nitrogen rather than submersed in liquid nitrogen.

General

Specific applications

Bacterial resistance testing adhesives

Fungus resistance testing

Fungus resistance testing adhesives

Fungus resistance testing airborne equipment

Fungus resistance testing aircraft transmissions

Fungus resistance testing automotive components

Fungus resistance testing packing materials

Fungus resistance testing paper and paperboard

Fungus resistance testing plastics

Fungus resistance testing polymers

Fungus resistance testing sandbags

Fungus resistance testing textiles

Produces endoglucanase

Sterility assurance

Testing aerosols

Testing slimicide

Degrades cotton fabric

Potential biocontrol agent: Fungal antagonist/mycoparasite

Recommended as a test microorganism for ASTM C1338: Standard Test Method for Determining Fungi Resistance of Insulation Materials and Facings

Recommended as a test microorganism for ASTM D2020: Standard Test Methods for Mildew (Fungus) Resistance of Paper and Paperboard

Recommended as a test microorganism for ASTM G21: Standard Practice for Determining Resistance of Synthetic Polymeric Materials to Fungi

Recommended as a test microorganism for ISO 846: Plastics — Evaluation of the action of microorganisms

Preceptrol

Characteristics

Comments: Genome sequencing strain (Broad Institute, USA).

Handling information

Medium

ATCC Medium 329: Mineral salts agar

ATCC Medium 340: Rabbit food agar

ATCC Medium 307: Cornmeal agar

Temperature

24-26°C

Atmosphere

Aerobic

Incubation

Filter paper required as carbon source

Handling procedure

For freeze-dry (lyophilized) ampoules:

Open an ampoule according to enclosed instructions.
From a single test tube of sterile distilled water (5 to 6 mL), withdraw approximately 0.5 to 1.0 mL with a sterile pipette and apply directly to the pellet. Stir to form a suspension.
Aseptically transfer the suspension back into the test tube of sterile distilled water.
Let the test tube sit at room temperature (25°C) undisturbed for at least 2 hours; longer (e.g., overnight) rehydration might increase viability of some fungi.
Mix the suspension well. Use several drops (or make dilutions if desired) to inoculate recommended solid or liquid medium. Include a control that receives no inoculum.
Incubate the inoculum at the propagation conditions recommended.
Inspect for growth of the inoculum/strain regularly. The sign of viability is noticeable typically after 3 to 5 days of incubation. However, the time necessary for significant growth will vary from strain to strain.

Handling notes

Genome sequencing strain (Broad Institute, USA)
Additional, updated information on this product may be available on the ATCC^® web site at www.atcc.org.

Quality control specifications

Sequenced data

18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

GGTCTCCGTTGGTGAACCAGCGGAGGGATCATTACAGAGTTGCAAAACTCCCTAAACCATTGTGAACGTTACCTATACCGTTGCTTCGGCGGGCGGCCCCGGGGTTTACCCCCCGGGCGCCCCTGGGCCCCACCGCGGGCGCCCGCCGGAGGTCACCAAACTCTTGATAATTTATGGCCTCTCTGAGTCTTCTGTACTGAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCATCAAGCCCCCGGGCTTGTGTTGGGGACCTGCGGCTGCCGCAGGCCCTGAAAAGCAGTGGCGGGCTCGCTGTCGCACCGAGCGTAGTAGCATACATCTCGCTCTGGTCGCGCCGCGGGTTCCGGCCGTTAAACCACCTTTTAACCCAAGGTTGACCTCGGATCAGGTAGGAAGACCCGCTGAACTTAAGCATATCAATAA

D1D2 region of the 28S ribosomal RNA gene

ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTTCGGCCCGAGTTGTAATTTGCAGAGGAAGCTTTAGGCGCGGCACCTTCTGAGTCCCCTGGAACGGGGCGCCATAGAGGGTGAGAGCCCCGTATAGTTGGATGCCTAGCCTGTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGTGACCAGACTTGCGCCGGGCGGATCATCCGGTGTTCTCACCGGTGCACTCCGCCCGGCTCAGGCCAGCATCGGTTCTCGCGGGGGGATAAAGGTCCTGGGAACGTAGCTCCTCCGGGAGTGTTATAGCCCGGGGCGTAATGCCCTCGCGGGGACCGAGGTTCGCGCATCTGCAAGGATGCTGGCGTAATGGTCATCAGCGAC

Verification method

Whole-genome Sequencing

History

Deposited as: Chaetomium globosum Kunze : Fries
Synonyms: Chaetomium globosum var. affine Tschudy, Chaetomium kunzeanum var. chlorina Saccardo, Chaetomium affine Corda, Chaetomium olivaceum Cooke et Ellis, Chaetomium kunzeanum Zopf, Chaetomium spirale Zopf, Chaetomium cochlioides Palliser, Chaetomium cochliodes Palliser, Chaetomidium barbatum Traaen, Chaetomium subterraneum Swift et Povah, Chaetomium ochraceum Tschudy, Chaetomium fibripilium Ames, Chaetomium mollipilium Ames, Chaetomium lusitanicum Gomes, Chaetomium subglobosum Sergeeva, Chaetomium rectum Sergeeva, Chaetomium spiculipilium Ames
Depositors: QM
Chain of custody: ATCC <-- QM <-- C Thom 1042.4
Cross references: GenBank KC146352 ITS including 5.8S rRNA gene

GenBank KC146368 D1/D2 region of 28S rRNA gene

GenBank AAFU00000000 Chaetomium globosum CBS 148.51, whole genome shotgun sequencing project

GenBank EF524036 Chaetomium globosum strain ATCC 6205 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence.

Legal disclaimers

Intended use

This product is intended for laboratory research use only. It is not intended for any animal or human therapeutic use, any human or animal consumption, or any diagnostic use.

Warranty

The product is provided 'AS IS' and the viability of ATCC^® products is warranted for 30 days from the date of shipment, provided that the customer has stored and handled the product according to the information included on the product information sheet, website, and Certificate of Analysis. For living cultures, ATCC lists the media formulation and reagents that have been found to be effective for the product. While other unspecified media and reagents may also produce satisfactory results, a change in the ATCC and/or depositor-recommended protocols may affect the recovery, growth, and/or function of the product. If an alternative medium formulation or reagent is used, the ATCC warranty for viability is no longer valid. Except as expressly set forth herein, no other warranties of any kind are provided, express or implied, including, but not limited to, any implied warranties of merchantability, fitness for a particular purpose, manufacture according to cGMP standards, typicality, safety, accuracy, and/or noninfringement.

Disclaimers

This product is intended for laboratory research use only. It is not intended for any animal or human therapeutic use, any human or animal consumption, or any diagnostic use. Any proposed commercial use is prohibited without a license from ATCC.

While ATCC uses reasonable efforts to include accurate and up-to-date information on this product sheet, ATCC makes no warranties or representations as to its accuracy. Citations from scientific literature and patents are provided for informational purposes only. ATCC does not warrant that such information has been confirmed to be accurate or complete and the customer bears the sole responsibility of confirming the accuracy and completeness of any such information.

This product is sent on the condition that the customer is responsible for and assumes all risk and responsibility in connection with the receipt, handling, storage, disposal, and use of the ATCC product including without limitation taking all appropriate safety and handling precautions to minimize health or environmental risk. As a condition of receiving the material, the customer agrees that any activity undertaken with the ATCC product and any progeny or modifications will be conducted in compliance with all applicable laws, regulations, and guidelines. This product is provided 'AS IS' with no representations or warranties whatsoever except as expressly set forth herein and in no event shall ATCC, its parents, subsidiaries, directors, officers, agents, employees, assigns, successors, and affiliates be liable for indirect, special, incidental, or consequential damages of any kind in connection with or arising out of the customer's use of the product. While reasonable effort is made to ensure authenticity and reliability of materials on deposit, ATCC is not liable for damages arising from the misidentification or misrepresentation of such materials.

Please see the material transfer agreement (MTA) for further details regarding the use of this product. The MTA is available at www.atcc.org.

Permits & Restrictions

Import Permit for the State of Hawaii

If shipping to the U.S. state of Hawaii, you must provide either an import permit or documentation stating that an import permit is not required. We cannot ship this item until we receive this documentation. Contact the Hawaii Department of Agriculture (HDOA), Plant Industry Division, Plant Quarantine Branch to determine if an import permit is required.

MORE INFORMATION ABOUT PERMITS AND RESTRICTIONS

References

Curated Citations

Greathouse GA, Ames LM. Fabric deterioration by thirteen described and three new species of Chaetomium. Mycologia 37: 138-155, 1945.

AATCC Antifungal Activity, Assessment on Textile Materials: Mildew and Rot Resistance of Textile Materials. Research Triangle Park, NC:American Association of Textile Chemists and Colorists;AATCC Test Method 30-2004.

ASTM International Standard Test Method for Mildew (Fungus) Resistance of Paper and Paperboard. West Conshohocken, PA:ASTM International;ASTM Standard Test Method D 2020-92 (Reapproved 2003).

ASTM International Standard Test Methods for Ability of Adhesive Films to Support or Resist the Growth of Fungi. West Conshohocken, PA:ASTM International;ASTM Standard Test Method D 4300-01.

ASTM International Standard Test Methods for Resistance of Adhesive Preparations in Container to Attack by Bacteria, Yeast, and Fungi. West Conshohocken, PA:ASTM International;ASTM Standard Test Method D 4783-01e1.

View All Curated Citations for this Product

Need assistance with this product? Contact our Technical Support team.

Email

Send us a message

Telephone

US and Puerto Rico

800-638-6597

Outside the US

+1-703-365-2700

Hours of Operation

Monday-Friday

9:00am - 5:00pm
US Eastern Time